Write the sequence of the messenger RNA molecule synthesized from a DNA template strand having the...
Write the sequence of the messenger RNA molecule synthesized from a DNA template strand having the sequence (make sure to indicate 5' and 3' ends):
(5')ATCGTACCGTTA(3')
Homework Answers
- During transcription the template strand of DNA is copied to form mRNA.
- Adenine pairs with uracil
- Thymidine pairs with adenine
- Guanine pairs with cytosine (and vice versa).
- The 2 strands are antiparallel.
- RNA is synthesised in 5' --> 3' direction.
5' ATCGTACCGTTA 3'
Or 3' ATTGCCATGCTA 5'
Therefore mRNA will be 5' UAACGGUACGAU 3'
If you found this answer helpful then please rate it. Comment if you have any problem in understanding this answer.
Add Answer to:
Write the sequence of the messenger RNA molecule synthesized
from a DNA template strand having the...
Here is a strand of mRNA: 5’-AAUCAUGUCCGAGGGCUACCCGUAG-3’ Write the sequence of the template strand of DNA...
Here is a strand of mRNA: 5’-AAUCAUGUCCGAGGGCUACCCGUAG-3’ Write the sequence of the template strand of DNA that gave rise to this messenger RNA.
The following is a fragment of double stranded DNA . The bottom strand is the template...
The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...
Why is transcription referred to ”DNA-Directed RNA synthesis”? A. The RNA sequence directs the synthesis of...
Why is transcription referred to ”DNA-Directed RNA synthesis”? A. The RNA sequence directs the synthesis of the template DNA strand. B. The sequence of the RNA strand is transferred to the DNA. C. RNA is synthesized using a template DNA strand. D. A double stranded RNA is synthesized using a single stranded RNA.
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...
You are given the following sequence of DNA which encodes for a short protein (this is...
You are given the following sequence of DNA which encodes for a short protein (this is the template strand). 3'ATAGAAGTACCTCGGGCATTTTGAGTTAGCCACTGATACAT 5' 1) Write the sequence of the coding strand. Make sure to label your ends to indicate directionality. 2) Write the sequence of the mRNA. Assume that the entire molecule will be transcribed. Make sure to label your ends to indicate directionality. 3) Write the primary structure sequence of the protein which this would make. Make sure to label your...
DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand....
DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand. Type the complementary RNA strand in the box Template strand: A ATAC GGCC Fill in the blank DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand. Type the complementary RNA strand in the box Template strand: A ATAC GGCC Fill in the blank
A portion of DNA sequence is 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom)...
A portion of DNA sequence is 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) Assume GTACCGATCAGCAGTCA and CATGGCTAGTCGTCAGT are introns 1) Which strand will be the template strand for the transcription? 2) Write down the mature messenger RNA sequence, label the 5' and 3' ends, and additional elements found in mature messenger RNA. 3) Based on the mRNA sequence, draw a line between each codon in question 2) and write the sequence for the polypeptide that can be...
If the template strand for replication (the DNA strand that the DNA polymerase binds to and...
If the template strand for replication (the DNA strand that the DNA polymerase binds to and "reads") has the sequence 5'-AGGCTTCGCTCCCG-3' then the complementary strand synthesized by the DNA polymerase would be what ?
1) The DNA template is read in the ______ direction, and the new strand is synthesized...
1) The DNA template is read in the ______ direction, and the new strand is synthesized in the ____ direction. A) 5' to 3' ; 3' to 5' B) 5' to 3' ; 5' to 3' C) 3' to 5' ; 5' to 3' D) 3' to 5' ; 3' to 5' 2) If a sequence of DNA is 5' AATTGCCGT 3', the complementary strand would be A) 3' AAAACGCCA 5' B) 3' TTAACGGCT 5' C) 5' ACGGCAATT 3' D)...
Transcribe each of the following DNA sequences. Label the TEMPLATE DNA strand The arrow shows the...
Transcribe each of the following DNA sequences. Label the TEMPLATE DNA strand The arrow shows the direction of transcription. Draw the corresponding RNA molecule and label the 5' and 3' ends
You are given the following sequence of DNA which encodes for a short protein (this is the template strand). 3'ATAGAAGTACCTCGGGCATTTTGAGTTAGCCACTGATACAT 5' 1) Write the sequence of the coding strand. Make sure to label your ends to indicate directionality. 2) Write the sequence of the mRNA. Assume that the entire molecule will be transcribed. Make sure to label your ends to indicate directionality. 3) Write the primary structure sequence of the protein which this would make. Make sure to label your...
DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand. Type the complementary RNA strand in the box Template strand: A ATAC GGCC Fill in the blank DNA to RNA Use the DNA template strand below to simulate transcription of an RNA strand. Type the complementary RNA strand in the box Template strand: A ATAC GGCC Fill in the blank
Transcribe each of the following DNA sequences. Label the TEMPLATE DNA strand The arrow shows the direction of transcription. Draw the corresponding RNA molecule and label the 5' and 3' ends
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago