Question

If a piece of DNA has the sequence: ATGCCG, which of the following would indicate a...

If a piece of DNA has the sequence: ATGCCG, which of the following would indicate a base substitution mutation?

ATGCCG

ATGGCG

TACGGC

ATGAACCG

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer: Option 2 (ATGGCG) is correct because in this only one nucleotide is changed during DNA replication.

Base Substitution is a gene-level mutation in which one nucleotide is substituted with another nucleotide during DNA Replication. In this, only a single nucleotide is affected in gene sequence so as a result only one codon is affected.

Add a comment
Know the answer?
Add Answer to:
If a piece of DNA has the sequence: ATGCCG, which of the following would indicate a...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • A single mutation has occurred in the following DNA sequence. 5' ATG TTC CAG CCA 3'...

    A single mutation has occurred in the following DNA sequence. 5' ATG TTC CAG CCA 3' wild-type (normal) sequence 5' ATG TTC TAG CCA 3' mutant sequence a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification. b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this classification.

  • A single mutation has occurred in the following DNA sequence. 5' ATG TTG GCC CAT 3'...

    A single mutation has occurred in the following DNA sequence. 5' ATG TTG GCC CAT 3' wild-type (normal) sequence 5' ATG TTG CCC CAT 3' mutant sequence    (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification. (1.75 marks)    (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you...

  • In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C...

    In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C nucleotide in the template strand to an A, the coding strand was unaffected. Original Template DNA: 3’ AGCCTTTGCTACGCCGACCACATTGCG 5’ a) Write out your new template DNA strand with this point mutation. b) What kind of base substitution occurred? Explain your answer. c) How does it affect the amino acid sequence derived from this DNA sequence? (Be specific, translate the mRNA)

  • The following sequence represents triplets on DNA TAC CAG ATA CAC TCC CCT GCG ACT A....

    The following sequence represents triplets on DNA TAC CAG ATA CAC TCC CCT GCG ACT A. Give the mRNA codons and tRNA anticodons that correspond with this sequence. B. Using the above piece of DNA, show a deletion, insertion, a substitution, and nonsense mutation. Which ones are frame-shift mutations? Are any of your mutations missense? Use the table of codons and amino acids in the textbook to answer this part of the question. For microbiology

  • Deleting the TTA in the following gene sequence: "TAC GTTACAGA ATCCGT" O A. would result in...

    Deleting the TTA in the following gene sequence: "TAC GTTACAGA ATCCGT" O A. would result in a frame shift mutation OB. would cut out an intron OC. would result in a base substitution OD. would make this a piece of mRNA Reset' Selection

  • Which mutation has a change in the DNA sequence but no change in the amino acid sequence?

    Question 12 Which mutation has a change in the DNA sequence but no change in the amino acid sequence? Question 4 Match the nucleotide pictures to their names.

  • 1) When a mutation occurs by elimination of one base in a DNA sequence, this mutation...

    1) When a mutation occurs by elimination of one base in a DNA sequence, this mutation is called a Explain. a) deletion mutation b) substitution (point) mutation c) translocation mutation d) viral mutation 2) Acids and bases denature a protein by disrupting peptide bonds and salt bridges amide bonds and alkene bonds hydrophobic interactions and peptide bonds Aluminum reacts with sulfuric acid. It produces a gas, and an aqueous solution. What mass (in g) of aluminum would completely react with...

  • The following is a eukaryotic DNA sequence. The coding sequence of the gene is in bold...

    The following is a eukaryotic DNA sequence. The coding sequence of the gene is in bold and italicized, and the promoter is enclosed in parenthesis. 5′ T G*A A G G A A T (TA T A A) T A C G A C C... A T G A T G T A C G C A T AAAC G T 3′ A mutation occurs in which a base (T) is inserted into the DNA sequence after the G, at...

  • Question 6 6. (1pts) The following DNA sequence 5-AGTCGCCCATGCCG-3' undergoes a mutation in which an A...

    Question 6 6. (1pts) The following DNA sequence 5-AGTCGCCCATGCCG-3' undergoes a mutation in which an A nucleotide is inserted at the 5' end of the molecule. How would you classify this mutation? Frameshift mutation Silent mutation Nonsense Mutation Missense mutation

  • If a mutation that alters EcoRI site 1 occurs in this piece of DNA, which lane...

    If a mutation that alters EcoRI site 1 occurs in this piece of DNA, which lane in the following gel would represent the results of EcoRI digestion?

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT