Which mutation has a change in the DNA sequence but no change in the amino acid sequence?
Question 12
Which mutation has a change in the DNA sequence but no change in the amino acid sequence?
Question 4
Match the nucleotide pictures to their names.
Homework Answers
Question 12.
Answer- A. silent mutation
Silent mutation does not have an observable effect on the phenotype of an organism.
Question 4.
Answer- A- adenine
B- Guanine
C-thymine
D- Cytosine
All these are bases that makeup nucleotide. a nucleotide is composed of base, sugar, and phosphate.
Please give a thumbs up!!!!!!!! Ask any doubts regarding the above question in the comment section !!!!!!!!!!! Thank you!!!!!
Add Answer to:
Which mutation has a change in the DNA sequence but no change in the amino acid sequence?
D Question 4 A silent mutation has no change in RNA sequence O no change to...
D Question 4 A silent mutation has no change in RNA sequence O no change to DNA, RNA, or protein O no change in protein sequence O no change in DNA sequence Question 5 Which mutation changes one amino acid for another? nonsense all of these are correct missense silent
In bacteria and eukaryotes, a mutation is when ________. the amino acid sequence in a protein...
In bacteria and eukaryotes, a mutation is when ________. the amino acid sequence in a protein molecule is directly changed the nucleotide sequence in an mRNA molecule is directly changed the nucleotide sequence in a DNA molecule is directly changed the expression of a gene changes without the DNA sequence being changed
DNA to Protein Describe the mutation that created the HbS allele: type of mutation, location of...
DNA to Protein Describe the mutation that created the HbS allele: type of mutation, location of mutation on HbA sequence (# of bases from beginning of sequence), nucleotide change (from which base to which base?). Describe the effect of this mutation on amino acid sequence of beta-globin polypeptide chain: effect of mutation on codon, which amino acid was changed (# amino acids from beginning of chain), what was the amino acid change (from which amino acid to which amino acid?)...
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
QUESTION 49 A type of mutation that does not alter the amino acid sequence of a...
QUESTION 49 A type of mutation that does not alter the amino acid sequence of a polypeptide even though the nucleotide sequence has been changed. Induced mutation Nonsense mutation Silent mutation Missense mutation None of the above 2 points QUESTION 50 Which of the following is an example of DNA damage? Loss of the helix structure of the DNA. A single break in the backbone...
Question 8 4 pts After a single base pair change, the following amino acid sequence was...
Question 8 4 pts After a single base pair change, the following amino acid sequence was altered. Original amino acid sequence: Met-Glu-Tyr-Leu-Phe Altered amino acid sequence: Met-Glu-STOP What was the change that occurred in the TEMPLATE DNA STRAND? Substitution or Indel Transition or transversion (or NA) Nucleotide changed by If substitution: Original nucleotide and then new nucleotide If insertion: Nucleotide inserted and then write "inserted" in the second space If deletion: Nucleotide deleted, and then write "deleted"
QUESTION 3 In a "frameshift" mutation O a the mutation is not in DNA. the nucleotide...
QUESTION 3 In a "frameshift" mutation O a the mutation is not in DNA. the nucleotide that mutates causes a stop codon to occur instead of the placement of an amino acid. c. addition or deletion of one or two nucleotides causes the codons to be off pattern and therefore the mutation. 4. the nucleotide that mutates causes no change in the amino acid specified.
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C...
In the following DNA sequence a nucleotide base change occurred at nucleotide 19, changing the C nucleotide in the template strand to an A, the coding strand was unaffected. Original Template DNA: 3’ AGCCTTTGCTACGCCGACCACATTGCG 5’ a) Write out your new template DNA strand with this point mutation. b) What kind of base substitution occurred? Explain your answer. c) How does it affect the amino acid sequence derived from this DNA sequence? (Be specific, translate the mRNA)
A substitution mutation is one in which one nucleotide base is changed to another
2. A substitution mutation is one in which one nucleotide base is changed to another Suggest ONE substitution A G mutation in the DNA that would cause the first amino acid in the "# of Eyes" gene to change from alanine (Ala) to valine (Val). In the table below, write the original.3. There is a substitution mutation in the gene for Fangs in which the first DNA base changes from guanine to thymine. The mutation results in a genetic disorder...
Which statement is correct about DNA mutation and DNA repair? A. DNA mutation always leads to...
Which statement is correct about DNA mutation and DNA repair? A. DNA mutation always leads to an impaired protein function A Question Progress A B. All organisms have elaborate mechanisms to repair DNA damage C. DNA mutation is a temporary change in DNA sequence D. Environmental mutagens are safe and won't cause cancer E. Homologous recombination is a type of genetic recombination in which nucleotide sequences are exchanged between two totally different molecules of DNA Reset Selection
D Question 4 A silent mutation has no change in RNA sequence O no change to DNA, RNA, or protein O no change in protein sequence O no change in DNA sequence Question 5 Which mutation changes one amino acid for another? nonsense all of these are correct missense silent
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
Question 8 4 pts After a single base pair change, the following amino acid sequence was altered. Original amino acid sequence: Met-Glu-Tyr-Leu-Phe Altered amino acid sequence: Met-Glu-STOP What was the change that occurred in the TEMPLATE DNA STRAND? Substitution or Indel Transition or transversion (or NA) Nucleotide changed by If substitution: Original nucleotide and then new nucleotide If insertion: Nucleotide inserted and then write "inserted" in the second space If deletion: Nucleotide deleted, and then write "deleted"
QUESTION 3 In a "frameshift" mutation O a the mutation is not in DNA. the nucleotide that mutates causes a stop codon to occur instead of the placement of an amino acid. c. addition or deletion of one or two nucleotides causes the codons to be off pattern and therefore the mutation. 4. the nucleotide that mutates causes no change in the amino acid specified.
Which statement is correct about DNA mutation and DNA repair? A. DNA mutation always leads to an impaired protein function A Question Progress A B. All organisms have elaborate mechanisms to repair DNA damage C. DNA mutation is a temporary change in DNA sequence D. Environmental mutagens are safe and won't cause cancer E. Homologous recombination is a type of genetic recombination in which nucleotide sequences are exchanged between two totally different molecules of DNA Reset Selection
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago