Question

The code below shows a piece of a gene. The promoter is shown in red, and the direction of transcription is marked by an arro
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Transcription occurs in 5'→3' direction. So, the DNA strand which will function as the template strand must consists of a promoter near the 3' end. As per the diagram given, 3'-TATAACGC.....TGACTCGC-5' will work as a template strand. The RNA polymerase will bind to the promoter and synthesize new RNA strand by recruiting complementary nitrogen bases one after another.

So, the sequence of the newly synthesized RNA will be as following....

5'UGCGUAUGGCAAUCCUUGAAGACUGAGCG3'

Add a comment
Know the answer?
Add Answer to:
The code below shows a piece of a gene. The promoter is shown in red, and...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is...

    4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...

  • Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to...

    Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to contain a very small gene. Transcription starts at the Transcription Start Site (TSS) after the promoter (shown in yellow), and proceeds in the direction of the arrow. Transcription stops at the end of the Transcription Terminator (shown in blue). 5' GTATAAATCCCTATGTTGACTTCAAAGGGCCCATGGAAGGGCTGATTCCTAAGA 3' 3' CATATTTAGGGATACAACTGAAGTTTCCCGGGTACCTTCCCGACTAAGGATTCT 5' a) Which strand of DNA shown, the top or the bottom, is the template strand? b) What is the...

  • A segment of a double-stranded DNA molecule is shown below. The start of a gene is...

    A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...

  • Which of the following accurately describes the promoter of a gene? a) It is the place...

    Which of the following accurately describes the promoter of a gene? a) It is the place on the DNA where RNA polymerase binds. b) It determines which DNA strand of a gene is used as a template. c) It is the first region of DNA that is transcribed into RNA. d) both a and b I think the answer is A but I'm not positive. C cannot be correct because the promoter does not get transcribed, and I don't think...

  • You wish to determine if there is a mutation somewhere within the promoter of the adult...

    You wish to determine if there is a mutation somewhere within the promoter of the adult b-globin gene that could possibly be responsible for a case of b-thalassemia. Which ONE method, when compared to the same process performed on wild type DNA, would NOT provide you with information that could be consistent with this idea? A) Prepare a pair of 18 nucleotide long primers that hybridize upstream and downstream of the promoter, perform PCR, and sequence the resulting fragment B)...

  • QUESTION 36 Consider the region of DNA below a segment of a bacterial gene. Several features...

    QUESTION 36 Consider the region of DNA below a segment of a bacterial gene. Several features of a "gene have been left out of this segment (eg promoter, terminator). Assume that the direction of movement of the RNA polymerase is from right to left (draw this on a piece of paper so that you can see it S ATAQOCATTCCATACCCAAS AGOTATGGGTT-T True or False The TOP strand serves as the template strand that you can see it) QUESTION / Consider the...

  • The diagram below shows a segment of DNA containing an imaginary gene (Z) and the primary...

    The diagram below shows a segment of DNA containing an imaginary gene (Z) and the primary RNA transcript that results from the transcription of gene Z. Exons are represented in green and introns are represented in blue. Which of the following choices represent mRNA molecules that could be produced from the primary RNA transcript by alternative RNA splicing? (In each choice, the yellow part on the left represents the 5' cap, and the yellow part on the right represents the...

  • Which of the following would be the consequence if the promoter of a gene has been...

    Which of the following would be the consequence if the promoter of a gene has been mutated so that it is no longer recognized by a sigma factor? A. Nothing, RNA polymerase is still able to bind. B. Capping of transcripts would be affected in those specific genes. C. Transcription of many genes regulated by the same sigma factor would be disrupted. D. RNA polymerase would require priming in order to transcribe new messages. E. Transcription of only that gene...

  • please explain a and b shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized...

    please explain a and b shkaryote 4. Transcription. The DNA below contains a promoter sequence recognized by E. coli RNA polymerase (NAF) TOUCA s. 5'-AACGTAACTGAATTCCGCAATGGCATGGCATTGCTCATTATACTTAGTCTAATATGTCAA-3' 3'-TTGCATTGACTTAAGGCGTTACCGTACCGTAACGAGTAATATGAATCAGATTATACAGTI-5 A THAT A) Draw boxes around the two promoter elements, centered at - 10 and -35, relative to the start site of transcription. B) Transcription starts at the A-T base pair, which is indicated by the bold letters in the DNA shown above. Based on the asymmetric promoter sequence, RNAP selects one strand as...

  • Can someone please help me answer these questions. Thank you! Eukaryotic transcription signals a) This drawing shows the placements of the four main sequences of the eukaryotic core promoter for RNA...

    Can someone please help me answer these questions. Thank you! Eukaryotic transcription signals a) This drawing shows the placements of the four main sequences of the eukaryotic core promoter for RNA polymerase II. Identify each one and give a brief explanation b) Which sequences are used in a DPE-driven promoter? c) Which ones are used in a TATA-driven promoter? d) Please draw and describe the steps as the transcription factors work with eukaryotic RNA polymerase II to start transcription of...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT