Homework Answers
Answer - (c)
A restriction enzyme is a protein which is used as a molecular scissors to cut the DNA at a specific site and to recognize palindromic DNA sequence.
Thank you
Add Answer to:
14. A restriction enzyme (for example BamH1): (2 points) a. Is a specific sequence of DNA...
Use a web search to determine where (in terms of the DNA sequence) the restriction enzyme...
Use a web search to determine where (in terms of the DNA sequence) the restriction enzyme BamH1 cuts the DNA.
find the errors Restriction enzymes recognize specific DNA sequences and cut each strand of DNA at...
find the errors
Restriction enzymes recognize specific DNA sequences and cut each strand of DNA at specific locations at the target sequence. The result of digesting a particular genome with a particular restriction enzyme is a collection of restriction fragments of defined length and composition. These can be used to generate restriction maps or create pieces with sticky ends. These sticky ends can be used to attach to other fragments that have sticky ends caused by cutting with a different...
1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this...
1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this plasmid into two fragments. A. True B. False 2.In general, restriction enzymes that recognize four nucleotides have higher probability to produce more DNA fragments than those enzymes that recognize six nucleotides. A. true B. false 3. Which of the following sequences are palindromes? A. 5' TGGCCA 3' B. 5' GAAAAG 3' C. 5' CGATGG 3' D. 5' GACGAC 3' 4. Below are the possible...
Restriction enzyme Fnu4HI cuts a four nucleotide DNA sequence GCGC. Assuming that the GC content of...
Restriction enzyme Fnu4HI cuts a four nucleotide DNA sequence
GCGC. Assuming that the GC content of a DNA molecule is 50%, what
will be the average size of a Fnu4HI fragment?
Restriction enzyme Fnu4Hl cuts a four nucleotide DNA sequence GCGC. Assuming that the GC content of a DNA molecule is 50%, what will be the average size of a Fnu4Hl fragment? O A: 0.25 kb O'B: 0.50 kb O C: 1 kb OD: 2 kb UE: 4 kb
2. 3. Give the recognition sequence for the restriction enzyme Eael in a dsDNA sequence, indicate...
2. 3. Give the recognition sequence for the restriction enzyme Eael in a dsDNA sequence, indicate the cleavage sites. (2) With reference to your PCR amplicon, detail the terminal DNA sequences at the two ends of the fragment that will be generated after digestion with Eael (indicate these in the two blocks below). What type of ends are generated by this enzyme (blunt/sticky, 5' or 3' overhang)? PCR amplicon بیا بیا
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1)...
2. Given the sequence of DNA 5’ GTTAATATAATTGCTACGCGAATTCGCTACAATCCAGGTACTTGCAA 3’ a. Construct the complementary DNA strand. (1) b. Identify the promoter region using the original strand. (1) c. Circle the start codon and stop codon using the original strand. (2) d. Construct the mRNA transcript. (1) e. List the amino acids produced by this sequence. (2) f. Determine the palindromic sequence of the EcoRI restriction endonuclease that recognizes the GAATTC sequence. (1) g. Would the EcoRI restriction enzyme be useful when...
Of the following steps to make recombinant DNA, which step occurs immediately after a restriction enzyme...
Of the following steps to make recombinant DNA, which step occurs immediately after a restriction enzyme recognizes specific nucleotide sequences?
Suppose you digest the genomic DNA of a particular organism with the restriction enzyme SauA. Then...
Suppose you digest the genomic DNA of a particular organism with
the restriction enzyme SauA. Then you ligate the resulting fragment
into a unique BamHI cloning site of a plasmid. The sequence of the
restriction sites and position of cleavage is shown below
Note: X and Y and their complementary bases Z and Y’
respectively can be any base (A,C, G, or T)
1) As you can see, ligation is possible because the two restriction
enzymes produce compatible sticky ends....
9. An alteration in the nucleic acid sequence in which a specific restriction endonuclease cuts can...
9. An alteration in the nucleic acid sequence in which a specific restriction endonuclease cuts can be detected by a. ELISA b. flow cytometry c. RFLP d. FISH 10. Which of the following techniques enables the identification of a particular sequence of nucleic acid on a cell or tissue? a. northern blot b. western Blot c. FISH d. southern blot 11. The polymerase chain reaction is used to a. convert RNA back into DNA b. amplify a target nucleic acid...
Write true or false ______ 1. The DNA sequence of one human being is on average...
Write true or false ______ 1. The DNA sequence of one human being is on average 99.9% identical to another random human being. ______ 2. As of 2009, all living human beings have had their entire genome sequenced. ______ 3. The nucleotide bases present in a DNA sequence are A, U, G, C. ______ 4. Techniques that enabled scientists to clone genes were developed in the 1970s. ______ 5. A restriction enzyme is useful because it is a generic enzyme...
find the errors
Restriction enzymes recognize specific DNA sequences and cut each strand of DNA at specific locations at the target sequence. The result of digesting a particular genome with a particular restriction enzyme is a collection of restriction fragments of defined length and composition. These can be used to generate restriction maps or create pieces with sticky ends. These sticky ends can be used to attach to other fragments that have sticky ends caused by cutting with a different...
Restriction enzyme Fnu4HI cuts a four nucleotide DNA sequence
GCGC. Assuming that the GC content of a DNA molecule is 50%, what
will be the average size of a Fnu4HI fragment?
Restriction enzyme Fnu4Hl cuts a four nucleotide DNA sequence GCGC. Assuming that the GC content of a DNA molecule is 50%, what will be the average size of a Fnu4Hl fragment? O A: 0.25 kb O'B: 0.50 kb O C: 1 kb OD: 2 kb UE: 4 kb
2. 3. Give the recognition sequence for the restriction enzyme Eael in a dsDNA sequence, indicate the cleavage sites. (2) With reference to your PCR amplicon, detail the terminal DNA sequences at the two ends of the fragment that will be generated after digestion with Eael (indicate these in the two blocks below). What type of ends are generated by this enzyme (blunt/sticky, 5' or 3' overhang)? PCR amplicon بیا بیا
Suppose you digest the genomic DNA of a particular organism with
the restriction enzyme SauA. Then you ligate the resulting fragment
into a unique BamHI cloning site of a plasmid. The sequence of the
restriction sites and position of cleavage is shown below
Note: X and Y and their complementary bases Z and Y’
respectively can be any base (A,C, G, or T)
1) As you can see, ligation is possible because the two restriction
enzymes produce compatible sticky ends....
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago