Of the following steps to make recombinant DNA, which step occurs immediately after a restriction enzyme...
Of the following steps to make recombinant DNA, which step occurs immediately after a restriction enzyme recognizes specific nucleotide sequences?
Homework Answers
after the restriction enzyme recognise the restriction site
- cleavage of the restriction site occur
- sticky ends are formed
- annealing of the gene of insert to the site where restriction enzyme made a cut.
- dna ligase is required to seal the gap.
Add Answer to:
Of the following steps to make recombinant DNA, which step
occurs immediately after a restriction enzyme...
14. A restriction enzyme (for example BamH1): (2 points) a. Is a specific sequence of DNA...
14. A restriction enzyme (for example BamH1): (2 points) a. Is a specific sequence of DNA b. Can be used to ligate DNA ends C. Recognizes palindromic DNA sequences d. Cuts random sequences of DNA
RECOMBINANT DNA: PLASMID VECTOR engineering is the direct manipulation of an organism's DNA using nology. To...
RECOMBINANT DNA: PLASMID VECTOR engineering is the direct manipulation of an organism's DNA using nology. To begin the recombinant DNA process, scientists must first ide at codes for the production of the protein they want to manufacture. One is to go backwards from the amino acid sequence of the desired protein to ide sequence of the gene. After scientists have identified the gene, they m it. Restriction enzymes or endonucleases from bacterial cells are key in th ia produce restriction...
find the errors Restriction enzymes recognize specific DNA sequences and cut each strand of DNA at...
find the errors
Restriction enzymes recognize specific DNA sequences and cut each strand of DNA at specific locations at the target sequence. The result of digesting a particular genome with a particular restriction enzyme is a collection of restriction fragments of defined length and composition. These can be used to generate restriction maps or create pieces with sticky ends. These sticky ends can be used to attach to other fragments that have sticky ends caused by cutting with a different...
1.) If we mix two restriction fragments cut with the same restriction enzyme in the presence of DNA ligase, ATP and appropriate buffer, we will obtain... A) protein B) carbohydrate C) recombinant DNA...
1.) If we mix two restriction fragments cut with the same restriction enzyme in the presence of DNA ligase, ATP and appropriate buffer, we will obtain... A) protein B) carbohydrate C) recombinant DNA or plasmid D) pAMP
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences...
1.When cloning a PCR product into a plasmid using restriction enzymes, the restriction enzyme recognition sequences in the PCR product most likely came from _______, and the restriction enzyme recognition sequences in the plasmid most likely came from ________. a. A multiple cloning site / the primers b. The primers / a multiple cloning site c. Both came from primers d. Both came from the multiple cloning site e. Naturally present in the gene of interest / the multiple cloning...
1. An enzyme used to covalently join DNA segments to form recombinant DNA molecules is called...
1. An enzyme used to covalently join DNA segments to form recombinant DNA molecules is called a A. Restriction endonuclease B. Reverse transcriptase C. DNA polymerase D. Helicase E. Ligase 7. The procedure for introducing changes into specific genes is called A. An enhancer trap B. Imprinting C. RT-PCR D. DNA looping E. Gene targeting 2. Plasmids used for in vitro cloning of foreign DNA fragments are called A. Donors B. DNA chips C. Clones D. Vectors E. Conjugants 8....
Identify each figure in the following diagram which depicts the generation of a recombinant plasmid from...
Identify each figure in the following diagram which depicts the
generation of a recombinant plasmid from plasmid and donor DNA. The
orange and yellow balls are protein molecules.
Identify each feature in the following diagram which depicts the generation of a recombinant plasmid from plasmid and donor DNA. The orange and yellow bals are protein molecules. recombinant plasmid restriction enzyme DNA ligase restriction site ligation G AA CTTAA C. Plasmid DNA AATTC CTTAA
Which statement best describes restriction enzymes? View Available Hint(s) Which statement best describes restriction enzymes? They...
Which statement best describes restriction enzymes? View Available Hint(s) Which statement best describes restriction enzymes? They randomly cut DNA molecules to generate numerous fragments. They are necessary for the polymerase chain reaction (PCR) to occur. They are important for cloning applications because they can be used to cut DNA at specific nucleotide sequences. They can cut only circular plasmid DNA.
CHAPTER 14: Using the restriction enzyme indicated, predict HOW MANY fragments will result after using that...
CHAPTER 14: Using the restriction enzyme indicated, predict HOW MANY fragments will result after using that enzyme to cut the DNA. Cut the DNA using Ddel 5' - TAGAGATCATTAATCCGGTGATCCAGGATTAATAGATCACTAG - 3' EcoR I recognizes the sequence 5²-ATT AAT-3' Hind III recognizes the sequence 5-GA-TC-3' Rsa I recognizes the sequence 5²-CC-GG-3' Dde I recognizes the sequence 5'-CCC GGG-3' Select one: a. 1 O b.4 Oc.2 O d. 5 e. 3 Check
Write true or false ______ 1. The DNA sequence of one human being is on average...
Write true or false ______ 1. The DNA sequence of one human being is on average 99.9% identical to another random human being. ______ 2. As of 2009, all living human beings have had their entire genome sequenced. ______ 3. The nucleotide bases present in a DNA sequence are A, U, G, C. ______ 4. Techniques that enabled scientists to clone genes were developed in the 1970s. ______ 5. A restriction enzyme is useful because it is a generic enzyme...
14. A restriction enzyme (for example BamH1): (2 points) a. Is a specific sequence of DNA b. Can be used to ligate DNA ends C. Recognizes palindromic DNA sequences d. Cuts random sequences of DNA
RECOMBINANT DNA: PLASMID VECTOR engineering is the direct manipulation of an organism's DNA using nology. To begin the recombinant DNA process, scientists must first ide at codes for the production of the protein they want to manufacture. One is to go backwards from the amino acid sequence of the desired protein to ide sequence of the gene. After scientists have identified the gene, they m it. Restriction enzymes or endonucleases from bacterial cells are key in th ia produce restriction...
find the errors
Restriction enzymes recognize specific DNA sequences and cut each strand of DNA at specific locations at the target sequence. The result of digesting a particular genome with a particular restriction enzyme is a collection of restriction fragments of defined length and composition. These can be used to generate restriction maps or create pieces with sticky ends. These sticky ends can be used to attach to other fragments that have sticky ends caused by cutting with a different...
1. An enzyme used to covalently join DNA segments to form recombinant DNA molecules is called a A. Restriction endonuclease B. Reverse transcriptase C. DNA polymerase D. Helicase E. Ligase 7. The procedure for introducing changes into specific genes is called A. An enhancer trap B. Imprinting C. RT-PCR D. DNA looping E. Gene targeting 2. Plasmids used for in vitro cloning of foreign DNA fragments are called A. Donors B. DNA chips C. Clones D. Vectors E. Conjugants 8....
Identify each figure in the following diagram which depicts the
generation of a recombinant plasmid from plasmid and donor DNA. The
orange and yellow balls are protein molecules.
Identify each feature in the following diagram which depicts the generation of a recombinant plasmid from plasmid and donor DNA. The orange and yellow bals are protein molecules. recombinant plasmid restriction enzyme DNA ligase restriction site ligation G AA CTTAA C. Plasmid DNA AATTC CTTAA
CHAPTER 14: Using the restriction enzyme indicated, predict HOW MANY fragments will result after using that enzyme to cut the DNA. Cut the DNA using Ddel 5' - TAGAGATCATTAATCCGGTGATCCAGGATTAATAGATCACTAG - 3' EcoR I recognizes the sequence 5²-ATT AAT-3' Hind III recognizes the sequence 5-GA-TC-3' Rsa I recognizes the sequence 5²-CC-GG-3' Dde I recognizes the sequence 5'-CCC GGG-3' Select one: a. 1 O b.4 Oc.2 O d. 5 e. 3 Check
Most questions answered within 3 hours.
-
Bicycling at 20 mph burns 11 Cal/min For how many
minutes would he have to bicycle...
asked 1 minute from now -
Conservation management for hairy-nosed wombats also includes a
captive breeding program. In the captive population of...
asked 10 minutes ago -
5.) Enter your answer in the provided box.
Calculate the following quantity: volume of 1.551 M...
asked 14 minutes ago -
A new, simple test has been developed to detect a particular
type of cancer. The test...
asked 16 minutes ago -
A woman is worried that she might have breast cancer. The
standard test for breast cancer...
asked 34 minutes ago -
In a large accounting firm, the proportion of accountants with
MBA degrees and at least five...
asked 43 minutes ago -
This site, with a monumental center, a ceremonial precinct with
massive mounds, sunken circular courts, and...
asked 46 minutes ago -
Examine the population trends in the two most recent stages of
economic development:
The Atlantic industrial...
asked 50 minutes ago -
Pepperoni Appreciation: Tony's Pizza Company
finds that 60% of the general population likes pepperoni pizza. I...
asked 1 hour ago -
Finding the WACC
asked 1 hour ago -
A person with heart disease has a heart that cannot increase
stroke volume at all, yet...
asked 1 hour ago -
If an open-open pipe resonator has a fundamental frequency of
200Hz , what is the frequency...
asked 1 hour ago