Question

EcoRI restriction mapping on a sample of a large piece of DNA resulted in six distinct...

EcoRI restriction mapping on a sample of a large piece of DNA resulted in six distinct bands following agarose gel electrophoresis. Similar mapping on an identical sample
that was subjected to high intensity ultraviolet light resulted in only four distinct bands. What might best explain the reduction in the number of detectable bands in the UV light-treated sample?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

This could be due ability of uv rays as a mutagen, UV rays works by forming thymine dimer in DNA . And we know that EcoR1 restriction site (GAATTC) contains thymine. Damage to these bases leads to abnormal clevage by restriction enzyme which may be the reason for difference in band numbers on gel after uv treatment.

If, it was helpful, give a thumps up. All the best

Add a comment
Know the answer?
Add Answer to:
EcoRI restriction mapping on a sample of a large piece of DNA resulted in six distinct...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Hello, I came across this question and I am confused on where to start. Restriction mapping...

    Hello, I came across this question and I am confused on where to start. Restriction mapping of a linear piece of DNA reveals the following EcoRI restriction sites. Site 1 Site 2 _2kb 4kb 5kb 1. This piece of DNA is cut by EcoRI the resulting fragments are separated by gel electrophoresis, and the gel is stained. Draw a picture of the bands that will appear in the gel below 2.If a mutation that alters EcoRI site 1 occurs in...

  • One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the...

    One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...

  • Genetics Restriction Mapping A 7.0kb plasmid is cut at a Pstl site and a 4.0kb piece...

    Genetics Restriction Mapping A 7.0kb plasmid is cut at a Pstl site and a 4.0kb piece of DNA is inserted forming a recombinant plasmid. A restriction digest is conducted and then visualized with agarose gel electrophoresis. Construct a plasmid map of the recombinant fragment using the foliowing size information (in kb about the cuts produced by the digest. Map this plasmid. The way to present your answer is very specific, see example below. 7.0 Pstl 4.0 6.0 ECORI 5.0 8.9...

  • A linear piece of DNA has the following restrictions sites: Xbal Noti Psti EcoRi 2 kb...

    A linear piece of DNA has the following restrictions sites: Xbal Noti Psti EcoRi 2 kb 4 kb -> 1 kb 2 kb 3 kb You decided to set up an experiment where you added one of these restriction enzymes to this DNA. After this DNA was digested with that restriction enzyme, you separated the resulting fragment(s) using agarose electrophoresis. After the gel was stained with ethidium bromide, you observed the following gel (the DNA ladder is your reference standard...

  • A linear piece of DNA has the following restrictions sites: You decided to set up an...

    A linear piece of DNA has the following restrictions sites: You decided to set up an experiment where you added one of these restriction enzymes to this DNA. After this DNA was digested with that restriction enzyme, you separated the resulting fragment(s) using agarose electrophoresis. After the gel was stained with ethidium bromide, you observed the following gel (the DNA ladder is your reference standard and is comprised of a series of DNA fragments of known length). a) Which restriction...

  • I need the answers for questions 2 and 3. My DNA ladder is in lane 2...

    I need the answers for questions 2 and 3. My DNA ladder is in lane 2 marked by the yellow arrow. Thanks! Here is the only other info I have. Thanks! Part 2: Gel purification and on Gel Slice and PCR Product Preparin modified from TBSci.com instructions for gaan A. Dissolving the Gel Stie Following electrophores, eral DNA band from grand place glice microcentrifuge tube Ib. Use an analytical balance to weigh pelice Rec die 2. Add 500 balance to...

  • help with questions 5 to 10 please PCB 3023L Lab #4 Protocol & Worksheet (30pt) You...

    help with questions 5 to 10 please PCB 3023L Lab #4 Protocol & Worksheet (30pt) You may work in your lab groups durine class. but all written answers must be completed individually in your own words. 1) Using the plasmid map for orientation 1 and the cDNA map as a guide, complete the plasmid map for orientation #2. (4pt) 612 1318 1 - EcoRi EcoRI Xbal ECORV -Xbal- 1662 +Bell EcoRI EcoRV Not FP -- Xhol X 2015 PRSP +...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT