Question

The following is an image of a section of dna. if a replication fork is moving from right to left, which strand (top or Bottom) is the template strand for the leading strand.

3' AAATCGCGATCGATGGTCTGAGTTTGAATC 5'

5' TTTAGCGCTAGCTACCAGACTCAAACTTAG 3'

Answer 1

The strand at the bottom is the template strand for the synthesis of leading strand if the replication fork moves from right to left.

DNA has anti-parallel nature i.e. one of the strands has 3'$\rightarrow$5' polarity whereas the other strand has opposite polarity i.e. 5'$\rightarrow$3'. Since DNA replication occurs only by elongating a 3' end, one of the strands is replicated continuously as the replication fork moves. The DNA strand synthesized by this template is known as the leading strand. The other strand of the DNA is replicated with the DNA polymerase moving in the opposite direction of the replication fork. The DNA strand synthesized by this template is known as the lagging strand and is synthesized in the form of short fragments called the Okazaki fragments.