Homework Answers
DNA Replication always starts from 5' to 3' direction by DNA polymerase. This DNA polymerase can add nucleotides to the 3' end of a strand.
So answer here is if asked from right to left, bottom
strand becomes as the template for the leading
strand.
Add Answer to:
3: AAATCGCGATCGATGGTCTGAGTTTGAATC -5' 5' TTTAGCGCTAGCTACCAGACTCAAACTTAG-3' The following is an image of a section of DNA. If...
The following is an image of a section of dna. if a replication fork is moving...
The following is an image of a section of dna. if a replication fork is moving from right to left, which strand (top or Bottom) is the template strand for the leading strand. 3' AAATCGCGATCGATGGTCTGAGTTTGAATC 5' 5' TTTAGCGCTAGCTACCAGACTCAAACTTAG 3'
The following is a small stretch of DNA sequence from middle of a bacterial open reading...
The following is a small stretch of DNA sequence from middle of a bacterial open reading frame that encodes a protein that is 450 amino acids in length : 5’-GCCTACTCTATGTTTACATCTGTGCTACGC – 3’ 3’-CGGATGAGATACAAATGTAGACACGATGCG – 5’ A) Which of the strands is the template strand for the mRNA that is transcribed from this DNA (“top strand” 5’ to 3’ left to right or “bottom strand” 5’ to 3’ right to left)? B) What is the basis for your answer to part...
4. The following is a small stretch of DNA sequence from middle of a bacterial open...
4. The following is a small stretch of DNA sequence from middle of a bacterial open reading frame that encodes a protein that is 450 amino acids in length: 5 «асстлcтстAтстттАСАТcтaтacтлсос - 3 3-CGGATGAGATACAAATGTAGACACGATGCG - 5' A. Which of the strands is the template strand for the mRNA that is transcribed from this DNA ("top strand" 5' 3' left to right or "bottom strand' 5 3 ' right to left)? B. What is the basis for your answer to part...
Which one of the following is true about DNA replication?
Which one of the following is true about DNA replication? The lagging strand is discontinuously synthesized in the direction away from the moving replication fork. The lagging strand is continuously synthesized in the direction away from the moving replication fork. The leading strand is continuously synthesized in the direction away from the moving replication fork. The leading strand is discontinuously synthesized in the direction away from the moving replication fork.
Below is a figure of a DNA molecule undergoing replication. The arrow indicates the direction the...
Below is a figure of a DNA molecule undergoing replication. The
arrow indicates the direction the replication fork is moving during
synthesis. From the list provided, indicate which option fits best
in each box on the diagram.
21
[ Choose ]
leading strand
template strand
lagging strand
22
[ Choose ]
leading strand
template strand
lagging...
In the following diagram, A and B are two Okazaki fragments generated during DNA replication. Open...
In the following diagram, A and B are two Okazaki fragments
generated during DNA replication. Open boxes represent the primers
and dotted lines represent the newly synthesized DNA strands.
a. To which direction (left or right) is the replication fork is
moving? (1 mark)
b. Which Okazaki fragment is made first in the diagram? Explain.
(2 marks)
c. (i) Which enzyme in E. coli synthesizes the primers on
Okazaki fragments? (1 mark)
(ii) What is the difference of this enzyme...
In the following diagram, A and B are two Okazaki fragments generated during DNA replication. Open...
In the following diagram, A and B are two Okazaki fragments generated during DNA replication. Open boxes represent the primers and dotted lines represent the newly synthesized DNA strands. B ---- Template DNA a. To which direction (left or right) is the replication fork is moving? (1 mark) b. Which Okazaki fragment is made first in the diagram? Explain. (2 marks) c. (i) Which enzyme in E. coli synthesizes the primers on Okazaki fragments ? (1 mark) (ii) What is...
Return 23 Subm 3 points In the image below, the long line across the center is...
Return 23 Subm 3 points In the image below, the long line across the center is a DNA strand, and the shorter "strings" are RNA molecules being transcribed from that DNA. Are the RNA polymerase molecules moving from right to left or left to right? How do you know? im Figure 7-8 Essen Cell Biology Garland Science 2010) BI A - A - Ix E 21 x x : 12pt Paragraph - VIKI Rakuten Ur Lanscription is the sequence of...
Label the 5' and 3' ends of the template and primer strands in this image, from...
Label the 5' and 3' ends of the template and primer strands in
this image, from left to right in the image.
Label the 5' and 3' ends of the template and primer strands in
this image, from left to right in the image.
template: 3' to 5'
primer: 3' to 5'
template: 5' to 3'
primer: 3' to 5'
template: 3' to 5'
primer: 5' to 3'
template: 5' to 3'
primer: 5' to 3'
Incoming nucleotide Template strand...
5) The following sequence of bases is present along one chain of a DNA double-helix that...
5) The following sequence of bases is present along one chain of a DNA double-helix that has opened up at a replication fork, and synthesis of an RNA primer on this template begins by copying the base in bold. 3' - ... TCT GAT ATC AGT ACG ... - 5' a) If the RNA primer consists of 8 nucleotides, what is its base sequence? b) In the intact RNA primer, which nucleotide has a free hydroxyl (-OH) terminus and what...
4. The following is a small stretch of DNA sequence from middle of a bacterial open reading frame that encodes a protein that is 450 amino acids in length: 5 «асстлcтстAтстттАСАТcтaтacтлсос - 3 3-CGGATGAGATACAAATGTAGACACGATGCG - 5' A. Which of the strands is the template strand for the mRNA that is transcribed from this DNA ("top strand" 5' 3' left to right or "bottom strand' 5 3 ' right to left)? B. What is the basis for your answer to part...
Below is a figure of a DNA molecule undergoing replication. The
arrow indicates the direction the replication fork is moving during
synthesis. From the list provided, indicate which option fits best
in each box on the diagram.
21
[ Choose ]
leading strand
template strand
lagging strand
22
[ Choose ]
leading strand
template strand
lagging...
In the following diagram, A and B are two Okazaki fragments
generated during DNA replication. Open boxes represent the primers
and dotted lines represent the newly synthesized DNA strands.
a. To which direction (left or right) is the replication fork is
moving? (1 mark)
b. Which Okazaki fragment is made first in the diagram? Explain.
(2 marks)
c. (i) Which enzyme in E. coli synthesizes the primers on
Okazaki fragments? (1 mark)
(ii) What is the difference of this enzyme...
In the following diagram, A and B are two Okazaki fragments generated during DNA replication. Open boxes represent the primers and dotted lines represent the newly synthesized DNA strands. B ---- Template DNA a. To which direction (left or right) is the replication fork is moving? (1 mark) b. Which Okazaki fragment is made first in the diagram? Explain. (2 marks) c. (i) Which enzyme in E. coli synthesizes the primers on Okazaki fragments ? (1 mark) (ii) What is...
Return 23 Subm 3 points In the image below, the long line across the center is a DNA strand, and the shorter "strings" are RNA molecules being transcribed from that DNA. Are the RNA polymerase molecules moving from right to left or left to right? How do you know? im Figure 7-8 Essen Cell Biology Garland Science 2010) BI A - A - Ix E 21 x x : 12pt Paragraph - VIKI Rakuten Ur Lanscription is the sequence of...
Label the 5' and 3' ends of the template and primer strands in
this image, from left to right in the image.
Label the 5' and 3' ends of the template and primer strands in
this image, from left to right in the image.
template: 3' to 5'
primer: 3' to 5'
template: 5' to 3'
primer: 3' to 5'
template: 3' to 5'
primer: 5' to 3'
template: 5' to 3'
primer: 5' to 3'
Incoming nucleotide Template strand...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago