Question

how to solve this problem about PCR ( no band or faint band )?? 1- PCR...

how to solve this problem about PCR ( no band or faint band )??
1- PCR product has high GC content .
2-Primers were designed or synthesized incorrectly .
3-Extension time was too short.
4-Incorrect annealing temperature.
5-Denaturation temperature was too low.
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Q. how to solve this problem about PCR ( no band or faint band )??

3-Extension time was too short.

Add a comment
Know the answer?
Add Answer to:
how to solve this problem about PCR ( no band or faint band )?? 1- PCR...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • You are provided with two primers below and you wish to amplify the CYC1 terminatoron pMD1:...

    You are provided with two primers below and you wish to amplify the CYC1 terminatoron pMD1: Primer 1: CTATGAAACAAGAATCGACC Primer 2: GTGCCGTAAAGCACTAAATC a. What secondary structure is formed by each primer at 54°C? b. What secondary structure is formed by both primers together at 54°C? c. If we were to use the following PCR protocol with primer 1 and primer 2, what would we expect to see on the electrophoresis gel? Step Time Temperature Initiation 2’ 95°C Denaturation 1’ 95°C...

  • Problem.1: What does a PCR optimization means? Problem.2: You are working on a gradient PCR to...

    Problem.1: What does a PCR optimization means? Problem.2: You are working on a gradient PCR to determine the optimum annealing temperature for your primer, and you get the following result. Problem.5: Your target is to amplify a promoter region of TRF2 gene. You design the following primer pair: Forward: 5'- CAGCGCTGCCTGAAACTC-3: Tm: 58.6°C, length: 18 bp, GC%: 61.11% Reverse: 5'- GTCCTGCCCCTTCACCTT-3' Tm: 59°C, length: 18 bp, GC%: 61.11% Product size: 200 bp -You get the following result: Marker CC CCC...

  • This PCR step is called annealing. The annealing step follows the denaturation step: it is usually...

    This PCR step is called annealing. The annealing step follows the denaturation step: it is usually the lowest temperature in the PCR. The temperature of this step varies with each PCR reaction because each primer has its own sequence and may not be an identical match to the DNA template strand. GC or CG have three hydrogen bonds and AT or TA have two hydrogen bonds. Higher annealing temperatures are more stringent and require a better match between primer and...

  • 1. Look up SNP cluster rs655492.    On what chromosome is it located? Look at the 100...

    1. Look up SNP cluster rs655492.    On what chromosome is it located? Look at the 100 nucleotide stretch that includes this SNP and the bases to either side. Design 2 PCR primers that would amplify the region containing the SNP?  Why did you pick these two primers? Things to consider might include Tm of each primer and where the primers would bind. 2. Under standard lab conditions, the expected melting temperature in degrees Celsius can be calculated from the equation Tm=...

  • Now. you should be able to answer the following questions: • How the amplification will be...

    Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...

  • Please, I need help with this question. Show work to solve the whole question 1. You...

    Please, I need help with this question. Show work to solve the whole question 1. You are interested in cloning a gene from the B. sanfranciscus genome, so you design PCR primers that should amplify a 1 kilobase pair (kbp) PCR product that contains the gene of interest.  After amplification, you will see if the PCR  was successful by loading the entire reaction onto an agarose gel and performing electrophoresis to see if a product of the expected size was generated.  To visualize...

  • Carolina Savirana Craz 3/12/20 GECC-Polymerase Chain Reaction 1. What is the purpose of the polymerase chain...

    Carolina Savirana Craz 3/12/20 GECC-Polymerase Chain Reaction 1. What is the purpose of the polymerase chain reaction? a. To repair damaged DNA b. To make copies of entire chromosomes c. To make copies of specific regions of DNA d. To prepare cells for cell division 2. The polymerase chain reaction is most comparable to what cellular process? a. Mitosis b. Replication c. Transcription d. Translation 3. When enzymes are elongating (building) a newly synthesized DNA strand in PCR, new nucleotides...

  • 1. The serum amyloid A (SAA) superfamily comprises a number of genes and proteins characterized f...

    1. The serum amyloid A (SAA) superfamily comprises a number of genes and proteins characterized from a range of mammalian species. These proteins are dramatically induced during the acute-phase injury response, suggesting an important short-term beneficial role in the response to tissue injury and inflammation. However, important disease associations have also been proposed for certain SAAs during chronic inflammation. Serum amyloid A contributes to a variety of conditions wherein normally soluble proteins become insoluble and are deposited in the extracellular...

  • Hi there, can you guys teach me how to solve the second problem, please? This problem...

    Hi there, can you guys teach me how to solve the second problem, please? This problem uses the data file called "12thWomanStoresData." Consider the variable Age. 1) What is the standard deviation of the age variable? 12.3890 years. (Round to 4 decimal places if necessary) 2) Now, supposed this variable was distributed normally. Between what two values would you expect to find 95% of the data observations? Answer: Between ... (on the low end) and ....... (on the high end)....

  • Student Name: Date Solve the Problem Solve the problems below. Justify your answer. Problem 1 Problem...

    Student Name: Date Solve the Problem Solve the problems below. Justify your answer. Problem 1 Problem 2 Sebastian and his two brothers read an Alan earned $1,284 a month for the past equal amount each week. They read for four months. He shared these earmnings a combined total of 135 minutes each equally among his savings, his checking week. They read the same amount of account, and his wallet. During the past time each each boy have read in 6...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT