Question

1. Look up SNP cluster rs655492.   

1. On what chromosome is it located?
2. Look at the 100 nucleotide stretch that includes this SNP and the bases to either side. Design 2 PCR primers that would amplify the region containing the SNP?  Why did you pick these two primers? Things to consider might include T_m of each primer and where the primers would bind.

2. Under standard lab conditions, the expected melting temperature in degrees Celsius can be calculated from the equation T_m= 59.9 + [0.41 × %(G + C)] – (675/length of duplex).

a.  What temperature would you need to anneal at for a PCR reaction containing the primers you designed in problem 1.

b.   If you were using the probe you designed in 1b, at about what temperature would you need to run your annealing reaction?

If you can answer these two questions, definite THUMBS UP! Please help!

Answer 1

1.a) It is located on chromosome 2.

b) Forward primer: 5' CACACCTGTAATCCCAGCACTTTG 3' (24 nucleotides, 50% GC)

Reverse primer: 5' ATCTCTACCCCAAAGTGGTACAACC 3' (25 nucleotides, 48% GC)

These two primers have almost identical Tm, their GC content is also good enough to run a proper PCR reaction. These primers will bind the flanking region of the SNP site. Therefore, they would amplify the region containing the SNP.

2) Now, we will calculate Tm of each primer:

For, forward primer:

_Tm= 59.9 + [0.41 × %(G + C)] – (675/length of duplex)

Tm = 59.9 + [0.41 × 50] – (675/24)

Tm = (59.9 + 20.5) - 28.12

Tm = 80.4 - 28.12

Tm = 52.28

For, reverse primer:

_Tm= 59.9 + [0.41 × %(G + C)] – (675/length of duplex)

Tm = 59.9 + [0.41 × 48] – (675/25)

Tm = (59.9 + 19.68) - 27

Tm = 79.58 - 27

Tm = 52.58

a) Annealing temperature should be <5 degree from the Tm of two primers. In that case, it would be 52-5 = 47 degree C.

b) If you were using the probe you designed in 1b, at 47 degree C, you would need to run your annealing reaction.