1. Look up SNP cluster rs655492.
2. Under standard lab conditions, the expected melting temperature in degrees Celsius can be calculated from the equation Tm= 59.9 + [0.41 × %(G + C)] – (675/length of duplex).
a. What temperature would you need to anneal at for a PCR reaction containing the primers you designed in problem 1.
b. If you were using the probe you designed in 1b, at about what temperature would you need to run your annealing reaction?
If you can answer these two questions, definite THUMBS UP! Please help!
1.a) It is located on chromosome 2.
b) Forward primer: 5' CACACCTGTAATCCCAGCACTTTG 3' (24 nucleotides, 50% GC)
Reverse primer: 5' ATCTCTACCCCAAAGTGGTACAACC 3' (25 nucleotides, 48% GC)
These two primers have almost identical Tm, their GC content is also good enough to run a proper PCR reaction. These primers will bind the flanking region of the SNP site. Therefore, they would amplify the region containing the SNP.
2) Now, we will calculate Tm of each primer:
For, forward primer:
Tm= 59.9 + [0.41 × %(G + C)] – (675/length of duplex)
Tm = 59.9 + [0.41 × 50] – (675/24)
Tm = (59.9 + 20.5) - 28.12
Tm = 80.4 - 28.12
Tm = 52.28
For, reverse primer:
Tm= 59.9 + [0.41 × %(G + C)] – (675/length of duplex)
Tm = 59.9 + [0.41 × 48] – (675/25)
Tm = (59.9 + 19.68) - 27
Tm = 79.58 - 27
Tm = 52.58
a) Annealing temperature should be <5 degree from the Tm of two primers. In that case, it would be 52-5 = 47 degree C.
b) If you were using the probe you designed in 1b, at 47 degree C, you would need to run your annealing reaction.
1. Look up SNP cluster rs655492. On what chromosome is it located? Look at the 100...
Please help with all questions. I provided all the information that I have. The sequence below represents the genomic DNA sequence of the first 440 bp of your gene of interest (exon 1 in blue). You want to amplify this full 440 bp region by PCR, for cloning into a plasmid vector. tgaagtccaactcctaagccagtgccagaagagccaaggacaggtacggctgtcatcacttagacctcaccctgtggagccacaccctagggttggccaatctactcccaggagcagggagggcaggagccagggctgggcataaaagtcagggcagagccatctattgcttacatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccatggtgcatctgactcctgaggagaagtctgccgttactgccctgtggggcaaggtgaacgtggatgaagttggtggtgaggccctgggcaggttgctatcaaggttacaagacaggtttaaggagaccaatagaaactgggcatgtggagacagagaagactcttgggtttctgataggcactgactctctctgcctattggtctattttcccaccc 1.1 Design a 20 nucleotide forward & reverse primer set that will allow you to amplify the sequence above. (note - primers should be at the beginning...
Now. you should be able to answer the following questions: • How the amplification will be done? - How you will determine your target sequence? How the amplification will be specific for certain segment? What are the requirements to carry PCR? • Suppose you perform a PCR that begins with one double-strand of the following DNA template: +5'-CTACCTGCGGGTTGACTGCTACCTTCCCGGGATGCCCAAAATTCTCGAG-3+ +3'-GATGGACGCCCAACTGACGATGGAAGGGCCCTACGGGTTTTAAGAGCTC-5'+ A. Draw one cycle of PCR reaction below the following diagram. B. Label the template DNA, the primers, and what is...
1. If you were trying to come up with an easy-to-remember analogy for the polymerase chain reaction, you would likely say PCR is similar to a colored pencils scissors dishwasher photocopier 2. What determines the piece of DNA that is amplified in PCR? The specific primers used The source of the DNA The temperature of each cycle The specific restriction enzyme used 3. What is the role of temperature in PCR? It is used to separate and anneal the nucleic...
Carolina Savirana Craz 3/12/20 GECC-Polymerase Chain Reaction 1. What is the purpose of the polymerase chain reaction? a. To repair damaged DNA b. To make copies of entire chromosomes c. To make copies of specific regions of DNA d. To prepare cells for cell division 2. The polymerase chain reaction is most comparable to what cellular process? a. Mitosis b. Replication c. Transcription d. Translation 3. When enzymes are elongating (building) a newly synthesized DNA strand in PCR, new nucleotides...
QUESTION 1: You are inserting a gene into an MCS found within the LacZ gene. Using blue/white colony selection, why could you assume that white colonies have modified plasmids? a. A blue colony means the LacZ reading-frame was disrupted b. A blue colony means your gene has mutations c. A white colony means the LacZ reading-frame is intact d. A white colony means the LacZ reading-frame was disrupted QUESTION 2: You are performing a PCR using primers with a sequence perfectly...
i
need help on the whole page!
24. What is the chemical group responsible for making these amino acids acidic? 25. List the 3 amino acids that can be phosphorylated using single letter names 20. If you want to mutate Tyrosine (Y) to keep it from being negatively charged, but keep it as close keep it as close in shape as possible to tyrosine, which amino acid would you change it to Use the single letter name. being negatively charged...
1. Describe the functions of the following reagents in extraction of DNA from corn meal: proteinase K; guanidine HCI; SDS 2. Why is the ratio of the OD at 260 and 280 nm used to estimate DNA purity? 3. In one paragraph, summarize basic principles of PCR technique in your own words. List all the reagents you will need to perform a PCR experiment. Does this method tell you what genetic modifications were made? If yes, describe how you can...
A cell's genome is its blueprint for life. However, what is the bare minimum number of genes needed to sustain a free-living cell? This is a question that microbiologists at the J. Craig Venter Institute (JCVI) have attempted to answer ever since they sequenced the genomes of several Mycoplasma species in the 1990s. Because Mycoplasma species are parasitic bacteria, their genomes are already reduced in size and hence provide an excellent foundation for creating a "minimal cell." However, little did...