Describe the regulation associated with attenuation. Describe how specifically this regulates the amount of various amino acids within a bacteria cell.
The process of attenuation is a regulatory characteristic that can be found in Bacteria and Archaebacteria that lead to premature termination or block of the transcription process. The attenuators are the 5'-cis-acting regulatory areas that fold into one of two substitutes of the RNA structures that conclude the accomplishment of transcription.
In bacteria cells, attenuation controls the trp operon. It involves the existence of a stop signal that signifies premature termination. Like the regulation of trp by the trp repressor, attenuation is a system for reducing the trp operon expression when the levels of tryptophan are elevated. Though, to a certain extent than blocking the initiation or beginning of transcription, attenuation stops the transcription end or completion.
Describe the regulation associated with attenuation. Describe how specifically this regulates the amount of various amino...
* 2.1 Describe different ways to classify amino acids and predict whether change in amino acid is likely to disrupt protein structure * 2.2 Compare and contrast the different levels of protein structure and how they relate to one another * 2.3 Describe the biochemical information that determines the final three-dimensional structure and explain what powers the formation of this structure * 2.4 Explain how structure determines function in general and using hemoglobin and myoglobin as specific examples. * 2.5...
1. Describe in detail how both positive and negative regulation control expression of the lac operon in bacteria. In doing this, also convey understanding of how and why expression of this operon is controlled two ways (positive and negative). Also answer, what are the energetic benefits to the cell of operon regulation? 2. What is horizontal gene transfer? Describe in detail the three mechanisms of horizontal gene transfer. What are the evolutionary advantages and costs of horizontal gene transfer. I...
is the process of the amino group removal from the amino acid, which allows the liver to make _____ from ______. a. Denaturation; dispensable amino acids; indispensable amino acids b. Exogenous; indispensable amino acids; dispensable amino acids c. Transamination; indispensable amino acids; dispensable amino acids d. Transamination; dispensable amino acids; indispensable amino acids Rachel, a collegiate figure skater, wants to consume a higher protein intake but is worried about the effects on her kidneys and bones. How would you advise...
Describe at least one federal regulation for healthcare. How does this regulation influence delivery, cost, and access to healthcare (e.g., CMS, OSHA, and EPA)? Has there been any change to the regulation within the past 5 years? Explain.
Describe how inorganic nitrogen is assimilated into glutamate and the other 19 amino acids used for protein synthesis. What are the products of amino acid oxidation and how do humans dispose of their nitrogenous waste?
Describe the chemical properties of amino acids and discuss how they can affect the final structure of a folded protein. In your answer, give examples of amino acid substitutions that could cause changes to a protein’s structure and function
Explain how a superantigen toxin non-specifically stimulates T cells. Why does non-specific stimulation of T cells make a person sick? Explain the molecular mechanisms by which quorum sensing regulates TSST-1 expression. How do superantigens promote immune evasion? Describe impacts on B cells and T cells Why is toxic shock syndrome associated with high absorbency tampons and menstruation?
3) Antibodies can be membrane-bound or secreted, depending on whether a stretch of additional amino acids are present or not. What process do you think determines if these amino acids are present? postranslational covalent attachment of a membrane spanning domain to the antibody alternative RNA splicing phosphorylation polyadenylation ubiquitin addition 10) How does the Cas9 system target where it produces a double-strand break in the DNA? The Cas9 protein binds to a recombinase, allowing it to disable the gene of...
Shown below is the trp mRNA leader. (A) How does attenuation in the trp operon work to control the levels of Trpe peptide? What happens when tryptophan levels are high in the cell? When they are low? (drawings may be used to assist in your explanation)(B) Does this happen in eukaryotes, prokaryotes or both? Why? (6 pts) Leader peptide Met-Lys - Al-te-Phe Val- mRNA PPPAAGUUCACGUAAAAAGGGUAUCGACAAUGAAAGCAAUUUUCGUACUGA GUAGUA MARCGAAAUGCGUACCACUUAUGUGACGGGCAANGUCCUUCACGCGGUGGU stop)-Ser-Thr-Arg - Trp - Top- ACCCAGCCCGCCUAAUGAGCGGGCUUUUUUUUGAACAAAAUUAGAGAAUAAGAAUGCAAACA Met-Gin-The- Trpt polypeptide Site of transcription attenuation...
1. Identify the basic shapes of bacteria and formation under the microscope. 2. Describe how bacteria are identified and named under the microscope. 3. Distinguish between Gram positive and Gram negative bacteria. 4. Explain the ways bacteria reproduce themselves. 5. Describe what makes prokaryotic cells different from eukaryotic cells. 6. Identify the internal and external structure of bacteria. 7. Define plasmids and how bacteria use them 8. Describe the 2 categories of bacteria found in the Moneran kingdom. 9. Bacterial...