6. Answer the following using numerical values:
a. A double-stranded DNA molecule is 300,000 basepairs long. This DNA molecule has how many complete helical turns? (Use a numerical answer, no words or units.)
b. A double-stranded DNA molecule is 300,000 basepairs long. How long is the DNA molecule in micrometers? (Use a numerical answer, no words or units.)
A) Helical turns are found per 10 base pairs in ds DNA.
That's why 300,000/10=30,000 turns are found in this DNA.
Answer is 30,000
------
B) There ar found 3.4 angstrom distance between two base pair. In micrometer, there are found distance of 0.00034
The length of DNA molecule is 300,000×0.00034=102 micrometer.
Answer is 102
6. Answer the following using numerical values: a. A double-stranded DNA molecule is 300,000 basepairs long....
1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a. If the DNA contains 28% adenosine residues, how many guanosine residues are in the DNA? b. Are the nucleotide compositions of each of the two individual strands of DNA identical? Explain. c. If the DNA is entirely in the B-DNA conformation: i. How many helical turns does the DNA contain? ii. What is the length of the DNA? 2. Write the sequence of a...
A double-stranded DNA molecule of 175 base pairs long had (A+T/(G+C) = 0.75. How many adenine nucleotides are there in this DNA? 75 37.5 150
In a long double-stranded DNA molecule containing the genetic information for many genes, the template strand for one gene may be the nontemplate strand for another gene. true or false
5) (3 pts) For a double-stranded DNA molecule, which of the following statements are true? If false, explain why. a. [A+C] = [G+T] b. [A+G] = [C+T) c. A=G and C=T d. A/T=C/G e. [A+T] = [G+C] f. C/A=T/G 6) (3 pts) Listed below are the base compositions of three different duplex DNA molecules. L S'ATTCTAACTTTGAT 3' 3' TAAGATTGAAACTA 5 IL S'CGCACTGGCTAACC 3' 3'GCGTGACCGATTGG 5' II. 5'CGCATTATTGTCAA 3' 3'GCGTAATAACAGTT 5' a) Order these three molecules in terms of their melting...
What part(s) of a nucleotide will occupy the major & minor groove of a double-stranded DNA molecule? WHY? What parts are found in the DNA backbone? WHY? Where would a Restriction Endonuclease associate with DNA? How long is a double-stranded DNA molecule that is 2 x 105 bp? How many nucleosomes would be required to package this DNA if it were in a Eukaryote? When chromatin from any eukaryote is digested briefly with micrococcal nuclease (an endonuclease) and fractionated using...
You are performing an analysis of squirrel mitochondrial DNA, which is a circular double-stranded DNA molecule that is 23,000 bp in length. You are using restriction enzymes and agarose gel electrophoresis in your experiments. You have decided to use two restriction endonucleases: Pstl and Tagl. The picture below shows their recognition sites, and the red arrows indicate their strand- Pstl (Providencia stuartii) CTGCAG GACGTC specific cleavage sites. Taqi (Thermus aquaticus) TCGA AGCT Part A: The Pstl and Taql enzymes both...
A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...
DNA is a double-stranded molecule where two polynucleotide strands run antiparallel to each other, and the bases on one strand are complementary to the bases on the opposite strand. If one strand of a DNA molecule has the following sequence of bases, what would the sequence be for the complementary, antiparallel DNA strand? 3' GCTGATCAGGAC 5'
Which of the statement is true? If a double-stranded DNA molecule of 125 million base pairs were scaled to the size of a human hair, it would have a diameter of 0.003 inches and be 1 mile long. If this scaled-up DNA molecule were condensed and compacted into a chromosome, into which of the objects below could that chromosome fit? A. a tennis ball B. a bathtub C. a pencil eraser D. a soda (pop) can E. a basketball
A number of factors influence the melting properties of a linear, double-stranded DNA molecule in a 0.25M sodium chloride solution. Considering this, explain each of the following observations: (a) The Tmincreases in proportion to the length of the molecule (b) As the concentration of sodium chloride is decreased, the Tm decreases (c) Renaturation of single strands to form double strands occurs more rapidly when the DNA concentration is increased (d) The Tm value is reduced when urea is added to...