8. Answer the following DNA sequences: Given the DNA sequence: 3’-CATCGAATGCAGGTT-5’ 5’-GTAGCTTACGTCCAA-3’ What is the total...
8. Answer the following DNA sequences:
Given the DNA sequence:
3’-CATCGAATGCAGGTT-5’ 5’-GTAGCTTACGTCCAA-3’ What is the total number of hydrogen bonds between the bases? (Use a numerical answer, no words or units.)
Given the DNA sequence:
3’-CATCGAATGCAGGTT-5’ 5’-GTAGCTTACGTCCAA-3’ What is the total number of phosphodiester bonds? (Use a numerical answer, no words or units.)
Homework Answers
8. Q1. 37
Q2. 28.
Add Answer to:
8. Answer the following DNA sequences:
Given the DNA sequence:
3’-CATCGAATGCAGGTT-5’ 5’-GTAGCTTACGTCCAA-3’ What is the total...
Determine the number of hydrogen and phosphodiester bonds present in the following DNA fragment: 5-CAGCTG-3 3-GTCGAC-5...
Determine the number of hydrogen and phosphodiester bonds present in the following DNA fragment: 5-CAGCTG-3 3-GTCGAC-5 hydrogen bonds= 16; phosphodiester bonds= 10 hydrogen bonds=14; phosphodiester bonds=5 O hydrogen bonds= 10; phosphodiester bonds= 5 hydrogen bonds= 12; phosphodiester bonds-6
Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’-...
Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’- GAT CCT GCC TAA -3’ Draw the non-template DNA sequence, the mRNA sequence and the resulting peptide. Label the terminus of the DNA and peptide!! Draw a point mutation. Is this a transition mutation or transverse mutation? Did it change the amino acid sequence(draw out the peptide)? 4 bp insertion, and the resulting peptide. 2 bp deletion, and the resulting peptide. A copy number...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
Identify two restriction endonucleases that could be used to make sticky ends near the 5’ end of this DNA sequence (uppe...
Identify two restriction
endonucleases that could be used to make sticky ends near the
5’ end of this DNA sequence (upper strand) so that
it could be incorporated into a new plasmid. You have a short list
of them in Table 9-2, and the specific, short sequences of bases
that other enzymes cut at are easily obtained from web resources.
You must cut as near to the 5' end as possible. Indicate the
specific sequences of bases for each endonuclease...
3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND...
3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND = = = = = = = = = = = = = = > TG A G C T A C CAC T T T A A c T C G AT GGT GAA AT DNA 3' STRAND < = = = = = = = = = = = = = = 5 A. In the following spaces, fill in the blanks...
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include...
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS
Genetics Helllppppp plllllleeeease. 31. Noting the following template DNA strand: 3'-TACGGTAAGCCTAAAATC-5' What will the mRNA sequence...
Genetics Helllppppp plllllleeeease. 31. Noting the following template DNA strand: 3'-TACGGTAAGCCTAAAATC-5' What will the mRNA sequence be that is transcribed from this DNA sequence above? Select one: a. 3'-AUGCCAUUCGGAUUUUAG-5' b. 5'-ATGCCATTCGGATTTTAG-3' c. 5'-AUGCCAUUCGGAUUUUAG-3' d. 3'-TACGGTAAGCCTAAAATC-5' 32. _______ first noted an acidic substance in the nuclei of cells from pus. Select one: a. Griffith b. Chargaff c. Meischer d. Garrod 33. A retrovirus produces an enzyme, called reverse transcriptase, which copies its RNA genome into DNA. This is opposite the central...
Below is a diagram of a section of a DNA molecule. Answer the question based on...
Below is a diagram of a section of a DNA molecule. Answer the
question based on the diagram. Here are the answers for
questions.
3' end of strand
5' end of strand
deoxyribose sugar
ribose sugar
hydrogen bonds between nitrogenous bases
phosphodiester bond containing phosphate group
purine bases
pyrimidine bases.
A indicates -
B indicates -
C indicates -
D indicates -
E indicates -
G indicates -
H indicates -
сн. о. он,С, А1 т он,с.
What is the total number of hydrogen bonds that exist between the DNA strand 5'-TTCAGAG-3' and...
What is the total number of hydrogen bonds that exist between the DNA strand 5'-TTCAGAG-3' and its complementary bond?
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5....
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
Determine the number of hydrogen and phosphodiester bonds present in the following DNA fragment: 5-CAGCTG-3 3-GTCGAC-5 hydrogen bonds= 16; phosphodiester bonds= 10 hydrogen bonds=14; phosphodiester bonds=5 O hydrogen bonds= 10; phosphodiester bonds= 5 hydrogen bonds= 12; phosphodiester bonds-6
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
Identify two restriction
endonucleases that could be used to make sticky ends near the
5’ end of this DNA sequence (upper strand) so that
it could be incorporated into a new plasmid. You have a short list
of them in Table 9-2, and the specific, short sequences of bases
that other enzymes cut at are easily obtained from web resources.
You must cut as near to the 5' end as possible. Indicate the
specific sequences of bases for each endonuclease...
3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND = = = = = = = = = = = = = = > TG A G C T A C CAC T T T A A c T C G AT GGT GAA AT DNA 3' STRAND < = = = = = = = = = = = = = = 5 A. In the following spaces, fill in the blanks...
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS
Below is a diagram of a section of a DNA molecule. Answer the
question based on the diagram. Here are the answers for
questions.
3' end of strand
5' end of strand
deoxyribose sugar
ribose sugar
hydrogen bonds between nitrogenous bases
phosphodiester bond containing phosphate group
purine bases
pyrimidine bases.
A indicates -
B indicates -
C indicates -
D indicates -
E indicates -
G indicates -
H indicates -
сн. о. он,С, А1 т он,с.
Below are several DNA sequences that are mutated compared with the wild-type sequence: 3-TAC TGACTGACGAT C-5. Envision that each is a section of a DNA molecule that has separated in preparation for transcription, so you are only seeing the template strand. Construct the complementary DNA sequences (indicating 5' and 3' ends) for each mutated DNA sequence, then transcribe (indicating 5' and 3' ends) the template strands, and translate the mRNA molecules using the genetic code, recording the resulting amino acid...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago