Question

Genetics Helllppppp plllllleeeease. 31. Noting the following template DNA strand: 3'-TACGGTAAGCCTAAAATC-5' What will the mRNA sequence...

Genetics Helllppppp plllllleeeease.

31. Noting the following template DNA strand: 3'-TACGGTAAGCCTAAAATC-5'

What will the mRNA sequence be that is transcribed from this DNA sequence above?

Select one:

a. 3'-AUGCCAUUCGGAUUUUAG-5'

b. 5'-ATGCCATTCGGATTTTAG-3'

c. 5'-AUGCCAUUCGGAUUUUAG-3'

d. 3'-TACGGTAAGCCTAAAATC-5'

32. _______ first noted an acidic substance in the nuclei of cells from pus.

Select one:

a. Griffith

b. Chargaff

c. Meischer

d. Garrod

33. A retrovirus produces an enzyme, called reverse transcriptase, which copies its RNA genome into DNA. This is opposite the central dogma because:

Select one:

a. a virus is not an organism.

b. a virus lacks genetic material.

c. a retrovirus lacks DNA.

d. the central dogma states that DNA is copied into RNA.

34. The genetic code is:

Select one:

a. triplet, overlapping, and not universal.

b. triplet, non-overlapping, and universal.

c. quaternary, overlapping, and non-universal.

d. doublet, non-overlapping, and with an inconsistent reading frame.

Which statement is correct?

35. Select one:

a. DNA polymerase proofreads DNA, correcting mismatched nucleotides as it copies DNA bases during replication

b. Primase removes short segments of RNA bases and replaces them with DNA

c. Ligase breaks the hydrogen bonds between complementary DNA strands creating breaks in the DNA

d. DNA polymerase unwinds the DNA at replication forks and helps glue breaks in the DNA

0 0
Add a comment Improve this question Transcribed image text
Answer #1

31) given DNA sequence is the sequence of the template strand so RNA produced is complementary to this in RNA Thymine is replaced with uracil so the answer is c. 5'-AUGCCAUUCGGAUUUUAG-3'

32) c. Meischer, Friedrich Miescher first identified DNA from the pus sample.

33) according to central dogma, DNA is transcribed to mRNA and mRNA is translated to protein in reverse transcription DNA is produced from RNA so the answer is d. the central dogma states that DNA is copied into RNA.

34) The genetic code consists of 3 nucleotides and the genetic code is universal that is the same genetic code is present in all organisms so the answer is b. triplet, non-overlapping, and universal.

35) a. DNA polymerase proofreads DNA, correcting mismatched nucleotides as it copies DNA bases during replication

ligase catalyzes the formation of phosphodiester bonds, DNA polymerase catalyzes polymerization reaction as well as it has a proofreading activity, primase adds RNA primer so the correct statement is a. DNA polymerase proofreads DNA, correcting mismatched nucleotides as it copies DNA bases during replication

Add a comment
Know the answer?
Add Answer to:
Genetics Helllppppp plllllleeeease. 31. Noting the following template DNA strand: 3'-TACGGTAAGCCTAAAATC-5' What will the mRNA sequence...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the...

    If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...

  • 1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA,...

    1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA, RNA, RNA polymerase, 3 5, 5 3', uracil, promoter, termination sequence, enhancer, nucleus, cytoplasm. What process often follows transcription? How is the genetic code used in this process ?

  • Here is a strand of mRNA: 5’-AAUCAUGUCCGAGGGCUACCCGUAG-3’ Write the sequence of the template strand of DNA...

    Here is a strand of mRNA: 5’-AAUCAUGUCCGAGGGCUACCCGUAG-3’ Write the sequence of the template strand of DNA that gave rise to this messenger RNA.

  • Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands...

    Unwinds DNA strand to make replication fork. Adds free nucleotides to the growing daughter DNA strands Adds short pieces of RNA to help DNA polymerase start Removes RNA and replaces with DNA Fuses or "glues" fragments of DNA together Proofreads or edits the DNA, checking for mistakes Given the following, DNA Sequence, what is the new daughter strand? (Did you label the 5' and 3' ends?) What is the name of the "fragments" of DNA on the lagging strand after...

  • 3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND...

    3' Given below are the complimentary strands of DNA with the genetic sequences: DNA 5' STRAND = = = = = = = = = = = = = = > TG A G C T A C CAC T T T A A c T C G AT GGT GAA AT DNA 3' STRAND < = = = = = = = = = = = = = = 5 A. In the following spaces, fill in the blanks...

  • 19. If a DNA sequence states: 5'-GCTTCCCAA-3 3'-CGAAGGGTT-5 nd assume the top strand is the template...

    19. If a DNA sequence states: 5'-GCTTCCCAA-3 3'-CGAAGGGTT-5 nd assume the top strand is the template strand used by RNA polymerase, what is the corresponding mRNA sequence? A.5'-GCUUCCCAA-3' C.5'-UUGGGAAGC-3 B. 3'-UUGGGAAGC-5 D. 5-TTGGGAAGC-3 E.3-TTGGGAAGC-5

  • t sequence of enzymes necessary for DNA replication are he Meli Primase, Topoisomerase. b) Helicase To...

    t sequence of enzymes necessary for DNA replication are he Meli Primase, Topoisomerase. b) Helicase To c) Helicase, Ton merase, Primase, DNA D merase II, and DNA Ligase erase, DNA Polymerasei t , and DNA Ligase d) Helicase, Topoisomerase, Primase, DNA Polymerase I, and DNA Ligase dDNA Ligase 58. DNA tesized in the 31 5' direction b) False 59. Eukaryotes have a single origin or replication a) True b) False Okaz 6U- KI Fragments are synthesized in the 3'-5' direction...

  • The following is a fragment of double stranded DNA . The bottom strand is the template...

    The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...

  • Write a concept map with the following terms. DNA Complementarity of bases Antiparallel Semiconservative replication Origin...

    Write a concept map with the following terms. DNA Complementarity of bases Antiparallel Semiconservative replication Origin of replication Replication fork Helicase SSBP Topoisomerase RNA Primase Polymerization proceeds 5’ to 3’ DNA polymerase Leading strand Lagging strand Okasaki fragments DNA ligase Bidirectional replication Telomeres Telomerase PCR Gel electrophoresis Restriction enzymes Palindromic sequence Southern blots Sanger dideoxy sequencing Genetic engineering Recombinant DNA Transgenic Organism GMOs

  • 24. What would be the anticodon if the template strand of DNA Is ACC A UCC...

    24. What would be the anticodon if the template strand of DNA Is ACC A UCC B.) TGG UGG D. ACC E. TCC 25. Prior to protein synthesis, the DNA A. attracts tRNAs with appropriate amino acids. 6.) serves as a template for the production of mRNA. C. adheres to ribosomes for protein synthesis. D. contains anticodons that become codons. E. must first undergo replication. 26. The Human Genome Project has revealed that human DNA has approximately A. 30,000 bases...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT