HomeworkLib
Question

19. If a DNA sequence states: 5-GCTTCCCAA-3 3-CGAAGGGTT-5
nd assume the top strand is the template strand used by RNA polymerase, what is the corresponding mRNA sequence? A.5-GCUUCCCAA-3 C.5-UUGGGAAGC-3 B. 3-UUGGGAAGC-5 D. 5-TTGGGAAGC-3 E.3-TTGGGAAGC-5
science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

Given Beavance Cading aand Ghoma Dame ao NAil

0 0
Add a comment
Know the answer?
Add Answer to:
19. If a DNA sequence states: 5'-GCTTCCCAA-3 3'-CGAAGGGTT-5 nd assume the top strand is the template...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • Here is a strand of mRNA: 5’-AAUCAUGUCCGAGGGCUACCCGUAG-3’ Write the sequence of the template strand of DNA...

    Here is a strand of mRNA: 5’-AAUCAUGUCCGAGGGCUACCCGUAG-3’ Write the sequence of the template strand of DNA that gave rise to this messenger RNA.

  • The following sequence of nucleotides is found in the DNA Template strand of a gene: ATTCCCAATAGAT...

    The following sequence of nucleotides is found in the DNA Template strand of a gene: ATTCCCAATAGAT LEFT RIGHT Direction of RNA pol Il movement Which of the following is correct? The mRNA sequence and polarity is: OA. 5' AUCUAUUGGGAAU 3' OB. The 5' end of the DNA template is on the LEFT OC. The 5' end of the DNA is on the RIGHT OD. A and B O E. A and C

  • 6) The following sequence of nucleotides is found in a single-stranded DNA template: ATT GCC AGA...

    6) The following sequence of nucleotides is found in a single-stranded DNA template: ATT GCC AGA TCA TCC CAA TAG AT Assume that RNA polymerase proceeds along this template from left to right. a) Which end of the DNA template is the 5' end and which end is 3'? b) What is the sequence of the complimentary DNA strand? c) Give the sequence and label the 5' and 3' ends of the mRNA copied from this template.

  • If a template DNA strand has the base sequence 3'-GTC...CCA-5, what would be the sequence of...

    If a template DNA strand has the base sequence 3'-GTC...CCA-5, what would be the sequence of the corresponding mRNA? (Note: "..." represents an intervening sequence) a. 3 CAG...GGU S' b. 5'CAG.GGU-3 OCCAGGGT-3 O d. 5'-GUC...CCA-5 Oe.3GUC...CCAS'

  • A portion of DNA sequence is    5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top)    3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom)...

    A portion of DNA sequence is    5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top)    3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) Assume GTACCGATCAGCAGTCA and CATGGCTAGTCGTCAGT are introns 1) Which strand will be the template strand for the transcription? 2) Write down the mature messenger RNA sequence, label the 5' and 3' ends, and additional elements found in mature messenger RNA. 3) Based on the mRNA sequence, draw a line between each codon in question 2) and write the sequence for the polypeptide that can be...

  • Genetics Helllppppp plllllleeeease. 31. Noting the following template DNA strand: 3'-TACGGTAAGCCTAAAATC-5' What will the mRNA sequence...

    Genetics Helllppppp plllllleeeease. 31. Noting the following template DNA strand: 3'-TACGGTAAGCCTAAAATC-5' What will the mRNA sequence be that is transcribed from this DNA sequence above? Select one: a. 3'-AUGCCAUUCGGAUUUUAG-5' b. 5'-ATGCCATTCGGATTTTAG-3' c. 5'-AUGCCAUUCGGAUUUUAG-3' d. 3'-TACGGTAAGCCTAAAATC-5' 32. _______ first noted an acidic substance in the nuclei of cells from pus. Select one: a. Griffith b. Chargaff c. Meischer d. Garrod 33. A retrovirus produces an enzyme, called reverse transcriptase, which copies its RNA genome into DNA. This is opposite the central...

  • The following is a fragment of double stranded DNA . The bottom strand is the template...

    The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...

  • Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...

    Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...

  • 1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA,...

    1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA, RNA, RNA polymerase, 3 5, 5 3', uracil, promoter, termination sequence, enhancer, nucleus, cytoplasm. What process often follows transcription? How is the genetic code used in this process ?

  • If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the...

    If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT