This DNA sequence represents an open reading frame (ORF) of a transcriptional unit. Transcribe and then translate this gene in the spaces provided below.
5' ATGGGAGCTGTTGTATTTGA 3'
3' TACCCTCGAGCAACATAAACT 5'
Transcribe mRNA sequence and translated protein sequence.
The given DNA sequence (ORF) is
5' ATGGGAGCTCGTTGTATTTGA 3'
3' TACCCTCGAGCAACATAAACT 5'
So, after transcription of the template strand (3' TACCCTCGAGCAACATAAACT 5') the resultant mRNA will be as following
5' AUGGGAGCUCGUUGUAUUUGA 3'
Consequently, after the translation of the mRNA, the amino acid sequence of translated protein will be as following
Met(Start) - Gly - Ala - Arg - Cys - Ile - (Stop)
**** IF YOU LIKE THE ANSWER PLEASE HIT THE THUMBS-UP. THANK YOU :-)
This DNA sequence represents an open reading frame (ORF) of a transcriptional unit. Transcribe and then...
3. Translation. According to the rules of the genetic code, there are six different reading frames in a double- stranded DNA molecule. One DNA strand serves as a template for transcription, which is complementary and antiparallel to the RNA product. The other DNA strand is the coding strand, which is identical in sequence to the RNA except for the substitution of uracil for thymine bases. A) There is a single open-reading frame (ORF) in the DNA molecule shown below. [Recall...
7. Open reading frames A protein coding gene includes the following sequence on one of its two DNA strands. Note that this segment (within an exon) does NOT include either the start codon or the stop codon for this gene. However, because five of the six potential reading frames (3 on each DNA strand) in this region include stops, only the true reading frame remains "open" through this segment. Therefore, it is possible to unambiguously decode (translate) this segment of...
The following is a small stretch of DNA sequence from middle of a bacterial open reading frame that encodes a protein that is 450 amino acids in length : 5’-GCCTACTCTATGTTTACATCTGTGCTACGC – 3’ 3’-CGGATGAGATACAAATGTAGACACGATGCG – 5’ A) Which of the strands is the template strand for the mRNA that is transcribed from this DNA (“top strand” 5’ to 3’ left to right or “bottom strand” 5’ to 3’ right to left)? B) What is the basis for your answer to part...
a) Transcribe and translate this sequence of DNA (write the mRNA sequence and protein code) TACATGCCG TTTCAG GGG TTAGGC GCGAAATGCATC mRNA: Protein: b) What happens if I insert an "A" at the 9* nucleotide position in the original sequence given? What is the protein message now? modified DNA: mRNA: Protein: c) Which enzyme was used during transcription? What is the machinery/organelle responsible for building the protein? I
Transcribe the DNA sequence below: translate the mRNA sequence below:
Transcribe the following DNA sequence into mRNA, and then translate it into protein. Be sure to figure out where translation would start, and where it would stop. DNA GGCTATACCGGTTACCGATAATTGGCTATCTG RNA: Protein:
4. The following is a small stretch of DNA sequence from middle of a bacterial open reading frame that encodes a protein that is 450 amino acids in length: 5 «асстлcтстAтстттАСАТcтaтacтлсос - 3 3-CGGATGAGATACAAATGTAGACACGATGCG - 5' A. Which of the strands is the template strand for the mRNA that is transcribed from this DNA ("top strand" 5' 3' left to right or "bottom strand' 5 3 ' right to left)? B. What is the basis for your answer to part...
Starting with this strand of DNA: 1) transcribe it into mRNA, 2) translate the mRNA into its corresponding protein (USING SINGLE LETTER ABBREVIATIONS of the amino acids), and 3) determine the protein sequence if you had a DELETION mutation of the emboldened thymine. 3’ 5’ TCGGCGTGTACTACTACACGGTATATACGTTTCTTTTGATTAGCCGCTT
I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions. 11 21 31 41 51 71 81 61 91 CGTAATTGAG GAGGTAGTTG ACGTATGAAT AGTTAACGTA CGGGGGGGAA 101 111 121 131 141 ACCCCCCCTT TTTTTTTTTC GAGCAATAAA AGGGTTACAG ATTGCATGCT a) Write down the corresponding sequences, find them in the sequence above and label them: -35 Consensus sequence: _(label as -35) -10 Consensus sequence (Pribnow box): _ __ (label as Pribnow) Shine-Dalgarno sequence in corresponding mRNA: __ (label as SD)...
The images below is DNA sequence (in reading frame) and the amino add translation far a region of a protein coding gene for two species you are researching. By comparing the two alignments and or using the translation table provided (remember U = T) mark all of the mutations in the DNA alignment as either non-synonymous (N) or synonymous (S). Place either an "N" or an "S" in the space above the mutation in the DNA alignment. How many non-synonymous...