Question

2 pts Match the following mutations with the effect they would produce Que Que Que Que the effect they Frameshift mutation. (
0 0
Add a comment Improve this question Transcribed image text
Answer #1
Frameshift mutation Every amino acid proceeding the mutation will be different , as a result, the protein will be different
Non-sense mutation The protein will be shorter, if the mutation occurs early on, the new protein may not be functional at all.
Silent mutation There will be absolutely no change in function, the protein will be identical.
Mis-sense mutation The protein will contain one different amino acid. But,depending if the new amino acid is of different types.
Add a comment
Know the answer?
Add Answer to:
2 pts Match the following mutations with the effect they would produce Que Que Que Que...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the...

    3. (1.8 points) The normal CFTR gene contains these six codons near the middle of the transcript: AUU UCU VUA GCA AGA GCU... Al The corresponding amino acids in the normal CFTR protein are: (Use either the one-or three-letter amino acid codes A naint mutation changes the last nucleotide from U to C. At the DNA level, this is a transition transversion c) At the protein level, this is a (silent / missense / nonsense/frameshift ) mutation. D) Instead of...

  • 11. Match each type of mutation with the corresponding description. (4 points) Missense An insertion or...

    11. Match each type of mutation with the corresponding description. (4 points) Missense An insertion or deletion of nucleotides that are not in multiples of 3. Nonsense A mutation that does not alter the protein sequence. Silent A mutation that confers an amino acid substitution. Frameshift A mutation that confers a premature stop codon.

  • Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of...

    Question 38 16 pts Question Code CDC The following sequence represents the DNA template strand of a gene, 3'-TAC CGT GTC TCC TCA GGC ATC-5' nucleotide number 1 21 a. What is the mRNA transcribed from this sequence? b. What is the amino acid sequence translated from the mRNA? c. If there is a transition at nucleotide #10, what is the amino acid sequence? R REROS d. What type of mutation is this (choose from frameshift, missense, nonsense, silent)? e....

  • Match the following kinds of mutations with their characteristics or means of correction . Each item...

    Match the following kinds of mutations with their characteristics or means of correction . Each item is used only once. DNA mismatch during DNA replication ultraviolet induced pyrimidine dimers double stranded DNA breaks apurinic sites single base pair deletion silent mutation missense mutation synonymous mutation Match the following kinds of mutations with their characteristics or means of correction. Each item is used only once. DNA mismatch during DNA replication [Choose] [Choose) ultraviolet induced pyrimidine dimers does not change function of...

  • Match each mutation with its appropriate description. A mutation that changes a codon that specifies an...

    Match each mutation with its appropriate description. A mutation that changes a codon that specifies an amino acid to a stop codon, resulting in premature termination of polypeptide synthesis. Silent mutation Frameshift mutation A mutation that results in a change in a codon such that a different amino acid is specified es Missense mutation A mutation that changes one codon to a different codon that specifies the same amino acid, such that there is no change in the resulting polypeptide....

  • 2. The following is a short mRNA. (Note: I have given you the mRNA already so...

    2. The following is a short mRNA. (Note: I have given you the mRNA already so just translate what I have given you. 5' CUCUACCUGGGGUGUAGAUGCACCUUGAUGGAGGGAUUCGUpuAGAUAGAGUGGG3 a. What is the amino acid sequence of the protein encoded for by this gene? b. If the gene above in "a" picks up the following mutation (indicated by bold and arrow), it is known (sense, nonsense, missense, frameshift, silent, etc.) mutation. as a 5 CUCUACCUGGGGUGUAGAUGCACCUTGAAGGAGGGAUUCGUUUUAGAUAGAGUGGG3 c. If the gene above in "a" picks up...

  • Which of the following statements regarding gene mutations is NOT true? Conditional mutations have different phenotypic...

    Which of the following statements regarding gene mutations is NOT true? Conditional mutations have different phenotypic effects under different conditions and can be used to study the function of essential genes. Silent mutations cannot have any phenotypic effect on an organism. Frameshift mutations often result in a truncated protein product, similar to a nonsense mutation. Dominant mutations have a phenotypic effect despite the presence of one functional wild type allele.

  • 1. You have used a mutagen to induce mutations in a DNA sequence.  If the original DNA...

    1. You have used a mutagen to induce mutations in a DNA sequence.  If the original DNA strand is 5'-ATGGGACTAGATACC-3', then which of the following represents a nonsense mutation? (1pt) 5'-ATGGGTCTAGATACC-3' 5'-ATGCGACTAGATACC-3' 5'-ATGTGACTAGATACC-3' 5'-ATGGGACTAAGATACC-3' 2. A mutation that changes a codon sequence, and subsequently changes the amino acid that should have been placed at that point in the polypeptide chain, is called a… (1pt) silent mutation frameshift mutation missense mutation nonsense mutation 3. Excision repair corrects DNA by (1pt) correcting A=T...

  • Explain what classifies a mutation as “temperature‑sensitive” by comparing phenotype(s) with a wildtype allele. How is this type of phenotype explained by protein behaviour? Would the following typ...

    Explain what classifies a mutation as “temperature‑sensitive” by comparing phenotype(s) with a wildtype allele. How is this type of phenotype explained by protein behaviour? Would the following types of mutations most likely have: severe effects, mild effects, or no effect on protein function? Briefly explain your answers. Note that there may be more than one correct answer, but you need only to give one sensible answer and explain your reasoning.                                                                                                                                               [6 marks] A nonsense mutation occurring in sequences encoding amino...

  • Dystrophin is a protein that forms part of a vital protein complex that connects the cytoskeleton...

    Dystrophin is a protein that forms part of a vital protein complex that connects the cytoskeleton of a muscle fiber cell to the extracellular matrix. This connection strengthens and shapes the muscle fibers. Dystrophin is coded by the DMD gene. This is one of the longest human genes known, covering 2,300,000 base pairs (0.08% of the human genome) It is located in chromosome 21. The immature mRNA is 2,100,000 bases long and takes 16 hours to transcribe. It contains 79...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT