Question

For the following single-stranded DNA molecule: 3’ – G T A C A A G T...

For the following single-stranded DNA molecule: 3’ – G T A C A A G T C A – 5’

1. Write the complementary strand, being sure to label polarity. (2 pts)

2. What is the GC content for the resulting double-stranded DNA molecule? (2 pts)

0 0
Add a comment Improve this question Transcribed image text
Answer #1

ANS.1-

Template Strand : 3'-G T A C A A G T C A-5'

Complementary Strand : 5'-C A T G T T C A G T-3'

ANS.2-

GC content - 40%

Add a comment
Know the answer?
Add Answer to:
For the following single-stranded DNA molecule: 3’ – G T A C A A G T...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 5) (3 pts) For a double-stranded DNA molecule, which of the following statements are true? If...

    5) (3 pts) For a double-stranded DNA molecule, which of the following statements are true? If false, explain why. a. [A+C] = [G+T] b. [A+G] = [C+T) c. A=G and C=T d. A/T=C/G e. [A+T] = [G+C] f. C/A=T/G 6) (3 pts) Listed below are the base compositions of three different duplex DNA molecules. L S'ATTCTAACTTTGAT 3' 3' TAAGATTGAAACTA 5 IL S'CGCACTGGCTAACC 3' 3'GCGTGACCGATTGG 5' II. 5'CGCATTATTGTCAA 3' 3'GCGTAATAACAGTT 5' a) Order these three molecules in terms of their melting...

  • QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10 The form of genetic reco...

    QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10 The form of genetic recombination that allows movement of genetic elements from one DNA site to another is termed: O A site-specific recombination O B. homologous recombination ° C. branch migration D.transposition QUESTION 9 Strand invasion requires a__, O A. 5', single-stranded B. 5', double-stranded ° C. 3, single-stranded O D.3', double-stranded DNA molecule. QUESTION 10...

  • DNA is a double-stranded molecule where two polynucleotide strands run antiparallel to each other, and the...

    DNA is a double-stranded molecule where two polynucleotide strands run antiparallel to each other, and the bases on one strand are complementary to the bases on the opposite strand. If one strand of a DNA molecule has the following sequence of bases, what would the sequence be for the complementary, antiparallel DNA strand? 3' GCTGATCAGGAC 5'

  • A segment of a double-stranded DNA molecule is shown below. The start of a gene is...

    A segment of a double-stranded DNA molecule is shown below. The start of a gene is indicated as the +1 base pair: + 1 5'TATATTTTCTATATGCACATTTGCAAGTAA 3'(strand A) 3'ATATAAAAGATATACGTGTAAACGTTCATT 5'(strand B) Uparrow (A) If RNA polymerase moves along this DNA from left to right, indicate the position of the promoter region on this DNA and indicate which strand is the template strand (B) Write the complete mRNA that would be transcribed from the gene above, again being sure to label the...

  • DNA is double stranded, but only one strand is used as a template for transcription. How...

    DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...

  • 1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a....

    1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a. If the DNA contains 28% adenosine residues, how many guanosine residues are in the DNA? b. Are the nucleotide compositions of each of the two individual strands of DNA identical? Explain. c. If the DNA is entirely in the B-DNA conformation: i. How many helical turns does the DNA contain? ii. What is the length of the DNA? 2. Write the sequence of a...

  • Part C this is for Genetics UUUUUUUUUUUUUUPPO 1 (UU (AA (CA 44. A double-stranded DNA molecule...

    Part C this is for Genetics UUUUUUUUUUUUUUPPO 1 (UU (AA (CA 44. A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT (UA (AL a. Which strand of DNA is the template strand, and in which direction is it transcribed? b. Label the 5' and the 3' ends of each strand. c. If an inversion occurs between the second and the third triplets from the left and right...

  • In the diagram below, you are provided with a known sequence of DNA (DNA Strand 1)....

    In the diagram below, you are provided with a known sequence of DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL LETTERS (e.g., GGCGGT), and work your way from the top to the bottom. A) Fill in the complementary DNA bases for DNA Strand 2 to form a complete double-stranded DNA molecule. B) Create an mRNA strand that is complementary to DNA Strand 1. C) Using the mRNA sequence that you just created, determine the complementary...

  • Regarding the four bases in DNA, the double-stranded DNA molecule is held together by complementary bases....

    Regarding the four bases in DNA, the double-stranded DNA molecule is held together by complementary bases. In the DNA molecule, guanine binds with ____________and adenine binds with ____________ in DNA; in RNA, adenine binds with _____________ instead. Therefore, if the codon on the DNA strand is CAG, then the mRNA codon that will bind to it will be _______________. For the DNA codon GAT, the amino acid that would result would be__________________. The following questions relate to chs. 3 and...

  • 5) The following sequence of nucleotides is found in a single-stranded DNA template: (3 pts)            ...

    5) The following sequence of nucleotides is found in a single-stranded DNA template: (3 pts)             ATTGCCAGATCATCCCAATAGAT Label the 5’ and 3’ ends of the DNA template. (1 pt) b) Give the sequence and label the 5’ and 3’ ends of the RNA transcribed from this template. (2 pts)

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT