Homework Answers
The template strand is read in either 5' to 3' direction or 3' to 5' direction.
Reason: For DNA synthesis, the reading frame is in 5' to 3' direction. This is because DNA polymerase synthesises new strand only in 5' to 3' direction. For RNA synthesis, the reading frame is 3' to 5' direction. Here, RNA polymerase reads the template strand only when it is oriented in 3' to 5' direction and the mRNA is synthesised in 5' to 3' direction.
Add Answer to:
The template strand of DNA is read Select one: O O O either 5' to 3'...
1) The DNA template is read in the ______ direction, and the new strand is synthesized...
1) The DNA template is read in the ______ direction, and the new strand is synthesized in the ____ direction. A) 5' to 3' ; 3' to 5' B) 5' to 3' ; 5' to 3' C) 3' to 5' ; 5' to 3' D) 3' to 5' ; 3' to 5' 2) If a sequence of DNA is 5' AATTGCCGT 3', the complementary strand would be A) 3' AAAACGCCA 5' B) 3' TTAACGGCT 5' C) 5' ACGGCAATT 3' D)...
Given the information coding of DNA strand: 5'-TTT-TAC-GAA-GAG-TGA-3', Write the corresponding DNA template and mRNA strand...
Given the information coding of DNA strand: 5'-TTT-TAC-GAA-GAG-TGA-3', Write the corresponding DNA template and mRNA strand DNA template: 3' ------ 5' ______________ ______________ _____________ ____________ ____________ mRNA Strand: 5'------3' _____________ _____________ ____________ ____________ ______________
If the template strand for replication (the DNA strand that the DNA polymerase binds to and...
If the template strand for replication (the DNA strand that the DNA polymerase binds to and "reads") has the sequence 5'-AGGCTTCGCTCCCG-3' then the complementary strand synthesized by the DNA polymerase would be what ?
Here is a strand of mRNA: 5’-AAUCAUGUCCGAGGGCUACCCGUAG-3’ Write the sequence of the template strand of DNA...
Here is a strand of mRNA: 5’-AAUCAUGUCCGAGGGCUACCCGUAG-3’ Write the sequence of the template strand of DNA that gave rise to this messenger RNA.
DNA is double stranded, but only one strand is used as a template for transcription. How...
DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...
Would the DNA strand indicated with an arrow in the figure below serve as a template...
Would the DNA strand indicated with an arrow in the figure below serve as a template for a leading or a lagging DNA strand? ان TTTTTTTTTTTT- کی 73% Select one a lagging Strand b. Leading Strand o © Type here to search * 00
PLEASE HELP WITH TABLE.thank you 1.Select the coding strand, and select the template strand from the...
PLEASE HELP WITH TABLE.thank you
1.Select the coding strand, and select the template strand from
the answers below. (Select more than 1 answer)
The coding strand is the first strand running from 5' to 3'.
The coding strand is the second strand running from 3' to
5'.
The template strand is the second strand running from 3' to
5'.
The template strand is the first strand running from 5' to
3'.
2.Given DNA sequence: 5’ TCCGATTGG 3’. Which of the...
*Template Strand of DNA 3. The following shows the first portion of a DNA strand of...
*Template Strand of DNA 3. The following shows the first portion of a DNA strand of a gene that is 2,500 base pairs long. AUG TACȚTCCCGGAGCCC--- TAAG LLL ODRAL a. What is the amino acid sequence encoded for by this strand starting with the T nucleotide on the left? Met b. Give an example of a synonymous substitution (a silent mutation) that could occur in the second codon of the DNA strand. c. Give an example of a nonsense mutation...
2) Given the following DNA sequence, identify the template strand, transcribe the template strand, and translate...
2) Given the following DNA sequence, identify the template strand, transcribe the template strand, and translate the mRNA. 5' GCGATGAAACGCCCGACGTAGGGC 3' 3' CGCTACTTTGCGGGCTGCATCCCG 5'
Given a template strand: 5' AGTATAGTGTTAGGTGTCATAGTACAAGG 3', which of the following could be used as a...
Given a template strand: 5' AGTATAGTGTTAGGTGTCATAGTACAAGG 3', which of the following could be used as a DNA primer? 5' CATAGTACAAGG 3' 5'AGTATAGTGTTA 3' O 5' TAACACTATACT 3' O No one of these primers recognise the given template O 5'CCTTGTACTATG 3'
DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...
Would the DNA strand indicated with an arrow in the figure below serve as a template for a leading or a lagging DNA strand? ان TTTTTTTTTTTT- کی 73% Select one a lagging Strand b. Leading Strand o © Type here to search * 00
PLEASE HELP WITH TABLE.thank you
1.Select the coding strand, and select the template strand from
the answers below. (Select more than 1 answer)
The coding strand is the first strand running from 5' to 3'.
The coding strand is the second strand running from 3' to
5'.
The template strand is the second strand running from 3' to
5'.
The template strand is the first strand running from 5' to
3'.
2.Given DNA sequence: 5’ TCCGATTGG 3’. Which of the...
*Template Strand of DNA 3. The following shows the first portion of a DNA strand of a gene that is 2,500 base pairs long. AUG TACȚTCCCGGAGCCC--- TAAG LLL ODRAL a. What is the amino acid sequence encoded for by this strand starting with the T nucleotide on the left? Met b. Give an example of a synonymous substitution (a silent mutation) that could occur in the second codon of the DNA strand. c. Give an example of a nonsense mutation...
2) Given the following DNA sequence, identify the template strand, transcribe the template strand, and translate the mRNA. 5' GCGATGAAACGCCCGACGTAGGGC 3' 3' CGCTACTTTGCGGGCTGCATCCCG 5'
Given a template strand: 5' AGTATAGTGTTAGGTGTCATAGTACAAGG 3', which of the following could be used as a DNA primer? 5' CATAGTACAAGG 3' 5'AGTATAGTGTTA 3' O 5' TAACACTATACT 3' O No one of these primers recognise the given template O 5'CCTTGTACTATG 3'
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago