Describe one mechanism by which double stranded RNAs can reduce or eliminate the production of protein from a particular gene.
Best example is siRNA which is short double stranded RNA. It break into single strand and this single strand bind with that gene whose protein synthesis have to be inhibited.
So that mRNA become double stranded so degrades and no synthesis of protein occur.
Describe one mechanism by which double stranded RNAs can reduce or eliminate the production of protein...
Double-stranded RNAs are processed by the enzyme _______ to form small interfering RNAs (siRNAs). One strand of the siRNA is loaded into a silencing complex named _________. The siRNAs target mRNA for ___________ . A. Dicer, RISC, degradation B. RISC, Dicer, spicing C. RISC, Dicer, degradation D. Dicer, RISC, splicing
Which protein binds to single-stranded DNA, allowing the single-stranded DNA to invade a double-stranded DNA double helix with sequence homology? O A. RecA OB. RecB OC. Single-stranded DNA binding protein OD. Recc O E. RecD
The following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. GCTAAATGGCAaaattgccggatgacGCACATTGACTCG Gaatcga GGTCAGATGC CGATTTACCGTtttaacggcctact CGTGTA ACTGAGCCttagctCCAGTCTACG write-out: The sequence of the primary transcript: The mature mRNA resulting from this stretch of DNA:
Suppose you are working on a gene that encodes a protein that triggers apoptosis of the cell (programmed cell death). In a certain cell, this gene is transcriptionally ON, that is, primary transcript is being made. Choose a mechanism by which to prevent or reduce the production of active apoptosis protein, and describe the specific properties of the new regulatory protein that the cell would have to make in order to do this.
21. Double helix22. Repressor protein23. Adenine24. Ribosome.25. Promoter26. Replication27. RNA Polymerase.28. CodonA. Enzyme that synthesizes RNAB. Organelle where proteins are assembledC. Complementary to either Thymine or UracilD. mRNA sequence that codes for one amino acidE. Shape of double stranded DNAF. Sequence of DNA that controls gene expressionG. binds an operator and stops gene expression in LAC operon by preventing RNA polymerase from binding gene and transcribing. H. Duplication of DNA in 5 phase of Interphase
Which of the following is NOT one of the primary ways a company can reduce its investment in inventory? eliminate bottlenecks in the production process find more reliable suppliers forecast sales more accurately add new product lines
Please choose from this list to fill in the blanks below. Some choices can be used more than once or not at all. Choices: rRNA, tRNA, miRNA, mRNA Typically forms internal base pairs to form a “cloverleaf” structure _________________ The primary transcript is larger than the final, mature form _____________________ Associates with proteins to form the ribosome ________________________ Drosha is needed to process this form of RNA ______________________ Contains protein-coding regions _________________________ This form of RNA contains the largest variety of nucleotide modifications ________________...
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT
Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to contain a very small gene. Transcription starts at the Transcription Start Site (TSS) after the promoter (shown in yellow), and proceeds in the direction of the arrow. Transcription stops at the end of the Transcription Terminator (shown in blue). 5' GTATAAATCCCTATGTTGACTTCAAAGGGCCCATGGAAGGGCTGATTCCTAAGA 3' 3' CATATTTAGGGATACAACTGAAGTTTCCCGGGTACCTTCCCGACTAAGGATTCT 5' a) Which strand of DNA shown, the top or the bottom, is the template strand? b) What is the...
Name two ways a virus can make multiple proteins from one gene and describe the mechanism for both?