Question

3. If each sigma factor recognizes a different promoter consensus sequence, how does the cell transcribe...

3. If each sigma factor recognizes a different promoter consensus sequence, how does the cell transcribe a gene that responds to multiple conditions, where each condition utilizes a different sigma factor? What would happen to overall gene expression profiles if RpoS were artificially overexpressed and why?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Sigma factors are proteinaceous regulators of gene expression in prokaryotes. These proteinaceous factors allow specialized binding of the RNA polymerase on the specific promoter sequenes thus allowing expression of specific genes in the bacteria, under conditions of stress/stimulus. Especially, each sigma factor identifies a different promoter sequence in the cells. Also, the bio-activation of these sigma factors is highly dependent upon the changes in physiological conditions of the cells. For example, cells generally express a sigma factor which encodes for normal gene expression. But under condition of heat stress, sigma-45 is generally expressed which upregulates the expression of heat-shock proteins in bacteria. It is important to note here that although the induced expression of gene changes but the native levels of all the vital protein are largely maintained in the cells. This ensures that the cell is able to maintain homeostasis even under stress. Thus, stress induced binding of different sigma factors can be based upon the fact native expression of gene remains unaltered.

Similarly, if the gene expression of RpoS is artificially enhanced, that would not largely affect the overall gene expression becuase mere presence of RpoS does not imply that stress-induced genes will be up-regulated in the cells. The physical presence of stress/stimulus is mandatory for bio-activation of these strerr-modulators of sigma factors and hence their binding to appropriate promoters.

Add a comment
Know the answer?
Add Answer to:
3. If each sigma factor recognizes a different promoter consensus sequence, how does the cell transcribe...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 5. Here is another promoter region in E. coli. (Also in a larger format in the...

    5. Here is another promoter region in E. coli. (Also in a larger format in the BlackBoard file) This one is between two genes. The gene whose start codon is underlined in red encodes an amino acid / proton symport. The gene whose start codon is underlined in blue encodes a protein used in glycolysis. The binding site for the CAP protein (with its cAMP cofactor) is indicated in green. SACASA & GAAS AAAAAAAAA AATTCCGTGTTGTATAATTT AĞCACAACATATTAAA CAP-CAMP AAAAAAAAAAAAAAAAAAAAAAAAA S L14...

  • Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dyst...

    Genetics Worksheet Week 3: Gene Regulation and Epigenetics 1. Duchenne muscular dystrophy is caused by a mutation in a gene that is 2.5 million nucleotides in length and encodes a protein called dystrophin. The dystrophin protein itself is 3684 amino acids in length. Calculate below the approximate size of the mRNA that encodes dystrophin. Approximately what percentage of the gene that encodes dystrophin is intron sequence? The human genome encodes a much greater variety and number of proteins than the...

  • Not sure how to answer these immunology questions! Help! 1) An otherwise healthy person is involved...

    Not sure how to answer these immunology questions! Help! 1) An otherwise healthy person is involved in an accident that requires kidney transplantation within a week. As the attending immunologist you are aware of three family members (no identical twins) that are willing to donate a kidney. What would you do to prepare the patient to minimize rejection?1) Detail three tests you would use to determine your ultimate donor tissue. Outline the rational that you would use to choice your...

  • The macromolecular complex that associates with each intron and splices it is called a(n). splicer acrosome...

    The macromolecular complex that associates with each intron and splices it is called a(n). splicer acrosome splice engine spliceosome splicing body Transcription in prokaryotes: 1. Requires consensus nucleotide sequences at position -35 and -10 in the promoter region of gene sequence. 2. Requires different sigma factors depending on the environmental stimulus. 3. Can produce a cDNA. All are correct. 3 1 Both 1 and 2 are correct. Which of the following statements about transcription factor TFIIH are correct: Two of...

  • 1. According to the paper, what does lactate dehydrogenase (LDH) do and what does it allow...

    1. According to the paper, what does lactate dehydrogenase (LDH) do and what does it allow to happen within the myofiber? (5 points) 2. According to the paper, what is the major disadvantage of relying on glycolysis during high-intensity exercise? (5 points) 3. Using Figure 1 in the paper, briefly describe the different sources of ATP production at 50% versus 90% AND explain whether you believe this depiction of ATP production applies to a Type IIX myofiber in a human....

  • summarizr the followung info and write them in your own words and break them into different...

    summarizr the followung info and write them in your own words and break them into different key points.   6.5 Metering Chamber: 6.5.1 The minimum size of the metering box is governed by the metering area required to obtain a representative test area for the specimen (see 7.2) and for maintenance of reasonable test accuracy. For example, for specimens incorporating air spaces or stud spaces, the metering area shall span an integral number of spaces (see 5.5). The depth of...

  • summatize the following info and break them into differeng key points. write them in yojr own...

    summatize the following info and break them into differeng key points. write them in yojr own words   apartus 6.1 Introduction—The design of a successful hot box appa- ratus is influenced by many factors. Before beginning the design of an apparatus meeting this standard, the designer shall review the discussion on the limitations and accuracy, Section 13, discussions of the energy flows in a hot box, Annex A2, the metering box wall loss flow, Annex A3, and flanking loss, Annex...

  • How can we assess whether a project is a success or a failure? This case presents...

    How can we assess whether a project is a success or a failure? This case presents two phases of a large business transformation project involving the implementation of an ERP system with the aim of creating an integrated company. The case illustrates some of the challenges associated with integration. It also presents the obstacles facing companies that undertake projects involving large information technology projects. Bombardier and Its Environment Joseph-Armand Bombardier was 15 years old when he built his first snowmobile...

  • I need Summary of this Paper i dont need long summary i need What methodology they used , what is the purpose of this...

    I need Summary of this Paper i dont need long summary i need What methodology they used , what is the purpose of this paper and some conclusions and contributes of this paper. I need this for my Finishing Project so i need this ASAP please ( IN 1-2-3 HOURS PLEASE !!!) SPECIAL ARTICLES tole of Monetary Policy C Rangarajan What should be the objectives of monetary policy? Does the objective of price stability conflict with the goal of achieving...

  • 10. Write a one-page summary of the attached paper? INTRODUCTION Many problems can develop in activated...

    10. Write a one-page summary of the attached paper? INTRODUCTION Many problems can develop in activated sludge operation that adversely affect effluent quality with origins in the engineering, hydraulic and microbiological components of the process. The real "heart" of the activated sludge system is the development and maintenance of a mixed microbial culture (activated sludge) that treats wastewater and which can be managed. One definition of a wastewater treatment plant operator is a "bug farmer", one who controls the aeration...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT