Question

Please help with these quesitons thanks!!! 1. why are the strans of a DNA molecule said...

Please help with these quesitons thanks!!!

1. why are the strans of a DNA molecule said to be complementary?

2. what steps are in eukaryotic DNA replication?

3. what enzyme joins individual nucleotides to produce the new strand of DNA?

4. what are the 3 components in DNA replication that require ATP?

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Ans. 1. Because (according to Chargaff’s rule) adenine (A) always pairs with thymine (T) and guanine (G) always pairs with cytosine (C), the base pairing is complementary. During DNA replication of one strand (template strand), the bases are added being added onto the newly synthesized strand are complementary to the template strand. Therefore, the both the strands- the template strand and the newly synthesized strand through it, in the resultant DNA molecule are also complementary. Therefore, the whole DNA is said to be complementary.

Ans. b. The steps of DNA replication in eukaryotes are-

Initiation- The DNA melts at multiple origin of replications. Primase enzyme synthesizes RNA primer on both the template strands.

Elongation- The replisome (DNA polymerase holoenzyme associated with replication fork on DNA) polymerizes new DNA strands and elongate them.

Termination- Replication terminates at certain DNA sequences (Ter sites) or when replisomes from opposite direction collide together.   

Ans. c. DNA polymerases (In eukaryotes- pol e replicates leading strand; pol d replicates lagging strand) join two individual nucleotides to produce new DNA strand.

And. d. Components of DNA replication requiring ATP

Dna A protein (have ATPase activity) hydrolyzes ATP to melt the DNA at origin of replication.

Dna B helicase loading onto the lagging strands requires ATP.

DNA gyrase requires ATP to removes negative supercoils originating during advancement of the replication fork.

Add a comment
Know the answer?
Add Answer to:
Please help with these quesitons thanks!!! 1. why are the strans of a DNA molecule said...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Vocabulary: DNA Replication

    Vocabulary: DNA Replication A. Helicase B. Primase C. Single Strand Binding Protein (SSB) D. Topoisomerase E. Origin of Replication F. DNA Polymerase G. Leading Strand H. Lagging strand I. DNA Ligase J. Okazaki Fragment K. Replication Fork L. RNA Primer M. Topoisomerase .1. Site where the replication of a DNA molecule begins. 2. The new continuous complementary DNA strand synthesized in the direction for the replication fork. 3. A discontinuously synthesized DNA strand that elongates in a direction away from the replication fork 4. Relaxes...

  • How DNA Is Copied 4. What does it mean that the two strands of DNA are...

    How DNA Is Copied 4. What does it mean that the two strands of DNA are complementary? 5. What is DNA replication?, 6. Using your notes, book, and this assignment, place the steps of DNA replication in the correct order. a. The enzyme DNA polymerase moves along the exposed strands and adds complementary nucleotides to each nucleotide in each existing strand. b. The DNA double helix breaks or unzips down the middle between the base pairs. C. A complementary strand...

  • Why does a new DNA strand elongate only in the 5' to 3' direction during DNA...

    Why does a new DNA strand elongate only in the 5' to 3' direction during DNA replication? The polarity of the DNA molecule prevents addition of nucleotides at the 3' en Replication must progress toward the replication fork. DNA polymerase can add nucleotides only to the free 3' end. DNA polymerase begins adding nucleotides at the 5' end of the template,

  • Why were Meselson and Stahl unable to distinguish between the dispersive and the semiconservative models following...

    Why were Meselson and Stahl unable to distinguish between the dispersive and the semiconservative models following only one round of DNA replication? 2. Describe in order, the four repeating steps that repeat over and over on the discontinuous lagging strand of DNA replication and name the major proteins required to carry out each of these steps in E. coli. The first function is given . I. Function: Create RNA primer Enzyme: II. Function: Enzyme: III. Function: Enzyme: IV. Function: Enzyme:...

  • I need the explanation for why is this the answer ! please. And answer the other...

    I need the explanation for why is this the answer ! please. And answer the other ones if you can. 3) If a species contains 23% A in its DNA, what is the percentage of guanine it would contain? A)23% B)46% C)25% D)44% E)27% 4) A nucleotide contains ADNA and RNA. Ba sugar and a phosphate. C)complementary purines and pyrimidines. D)RNA, protein, and lipids. E)a sugar, a phosphate, and a nitrogen-containing base. 5) In the Watson-Crick model of DNA, the...

  • Where would you find histones? A. Part of the RNA polymerase complex that transcribes DNA. B....

    Where would you find histones? A. Part of the RNA polymerase complex that transcribes DNA. B. In a virus, helping to "inject" foreign DNA into a cell. C. Bound to an enhancer to regulate transcription. D. Asscoiated with DNA to make chromatin. What is the role of DNA ligase during DNA replication? A. It unwinds the parental double helix. B. It synthesizes RNA nucleotides to make a primer. C. It joins lagging strand (Okazaki) fragments together. D. It stabilizes the...

  • 16.128 QUESTION 7 Please choose the answer which best fits the statement below. Not all answers...

    16.128 QUESTION 7 Please choose the answer which best fits the statement below. Not all answers will be used. This enzyme joins Okazaki fragments. A. Single strand binding protein These proteins help stabilize the two strands of B. DNA helicase the DNA at the replication bubble- they help C. Topoisomerase keep the strands from readhering to one D. DNA ligase another This enzyme adds new DNA nucleotides during E. DNA polymerase DNA replication This enzyme catalyzes the unwinding of the...

  • I need help on question 6 fill in the blanks 6. Cystic fibrosis is autosomal recessive...

    I need help on question 6 fill in the blanks 6. Cystic fibrosis is autosomal recessive (r). The genotype of a CF patient should be Huntington's disease is a disorder. The possible genotypes of a Huntington patient are Hemophilia is a disorder. Both parents are normal, their son has hemophilia. What is the mother's genotype? What is the father's genotype? What is the son's genotype? If they have a daughter, what would her phenotype be? Her possible genotype should be...

  • 1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2....

    1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...

  • Only answers please don’t show work 33) Viral DNA incorporated into host cell DNA is known...

    Only answers please don’t show work 33) Viral DNA incorporated into host cell DNA is known as a/an A) phage. B) envelope C) capsid. 33) 34) How is transformation in bacteria most A) the creation of a strand of RNA from DNA molecule B) the type of semiconservative by DNA C) the infection of cells by a phage DNA molecule D) the e of a strand of DNA from an RNA molecule E) assimilation of external DNA into a cell...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT