
Just be need help with #4 er your nandwriting must be egible order to receive dealt...
Question 3 (4 pts): The following table provides just enough information about a section of a particular gene to allow you to determine: (a) the sequence of the base pairs along the DNA, (b) which DNA strand serves as the template for mRNA transcription, (c) the mRNA nucleotide sequence, (d) the tRNA anticodons, and (c) the amino acid sequence of the polypeptide. Complete the table and make sure you indicate which DNA strand is the template for mRNA transcription and...
1. Do all parts: a. The sequence of a gene on mRNA is normally AUGCCCGACUUU. The point mutation in the gene results in the MRNA sequence AUGCCGGACUUU. What are the amino acid sequence for the normal and mutant proteins? Say, with an explanation whether you expect this to be a silent mutation. b. Why is DNA polymerase said to be template-directed? If a RNA had the nucleotide sequence 5'-AUGCCAUAACGAUACCCCAGUC-3', what was the sequence of the DNA strand that was transcribed...
The amino acid sequence of a portion of a polypeptide is N...Gly-Glu-Met-Tyr-Trp-Lys-Ala...C. I just need help with part C A. Determine the mRNA sequence encoding this polypeptide fragment. 5'-G-G-N-G-A-Pu-A-U-G-U-A-Py-U-G-G-A-A-Pu-G-C-N-3' B. Determine the DNA template strand sequence corresponding to the mRNA above. 5' N-G-C-Py-T-T-C-C-A-Pu-T-A-C-A-T-Py-T-C-N-C-C- 3' C. Determine the DNA coding strand sequence corresponding to the template strand above. Express your answer as a sequence of nucleotides separated by dashes. Use N to represent any nucleotide (A, T, C or G), Pu...
1. The following nucleotide sequence is found on a strand of mRNA. Give the altered amino acid sequence of the protein that will be found in each of the following mutations. Please also list an anticipated phenotypical change(s) (nonsense, missense, frameshift, addition/subtraction of amino acid etc.) (1 pts each) Second position Nucleotide #: 1 4 7 10 13 U UUU 16 19 22 UCU UAU UGU UUC UAC UAA UUA UUD RNA: 5-AUG ACC GGC AAU CAA CUA UAU UGA-3'...
1.) An RNA molecule has the following percentrages of bases A = 27% , U=38% , C=20% , G= 15% a. Is this RNA molecules single stranded or double stranded? How Cant you tell? b. What would be the percentage of each of the bases in the template strand of the DNA that contains the genes for this RNA? 2.) Given the following DNA 5' ATG GCG AGG CGG CAGCTGTTATGGTGA - 3' a. What is the transcript (mRNA) sequence? b....
The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...
need help with part c
Scie Clas Class DNA to Proteins (Gene Expression) You are given the DNA template: 3' A-A-T-A-G-T-A-C-G-C-G-A-G-T-C-G-T-G-A-T-G-A-A-A- T-T-C-TS' Complete the following exercise: A. DNA replication. Write the sequence of complementary bases produced if the above DNA template undergoes replication. 3'A-A-T-A-G-T-A-C-G-C-G-A-G-T-C-G-T-G-A-T-G-A-A- A-T-T-C-T5' 3 T-T-A-T-C-A-T-G-C-G-C-T-C-A-G-C-A-C-t-A-C-T-T- T-A-A-G-AS' B. Transcription. Using the original DNA template, construct the sequence of nucleotide bases for the transcribed RNA strand. 3'AAT-AGT -ACG-CGA-GTC-GTG -ATG-AAA -TTC-T 3'UVA - UCA-UGC-GCU-CAG-CAC-AC - VUU-AAG-A5 C. Translation. Using the mRNA...
TranslationOverview:The purpose of this activity is to help the students to understand how replication, transcription, and translation are connected. Students will use a sequence from a bacterial gene that confers resistance to antibiotics (carbapenems). They will be asked to apply the knowledge obtained in the class lecture to (1) find the promoter in the sequence, (2) determine the amino acid sequence of a fragment of the polypeptide, (3) "reverse translate" a fragment of the polypeptide, and (4) identify mutations in...
1) Using the bacterial DNA sequence that the instructor gave you:a. Identify and underline the promoter region and the start codon.b. Identify the coding and template strandc. Transcribe the coding sequenced. Translate the mRNA sequence8) Which of the following mutational changes would you predict to be the most deleterious to gene function? Explain your answers.a. Insertion of a single nucleotide near the end of the coding sequence.b. Removal of a single nucleotide near the beginning of the coding sequence.c. Deletion...
Please help with 4-10!
DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...