Question

DNA fragments that are 500 bp, 1000 bp, and 2000 bp in length are separated by...

DNA fragments that are 500 bp, 1000 bp, and 2000 bp in length are separated by gel electrophoresis. Which fragment will migrate farthest in the gel?

2000 bp fragment

1000 bp fragment

500 bp fragment

all will migrate equal distance

0 0
Add a comment Improve this question Transcribed image text
Request Professional Answer

Request Answer!

We need at least 10 more requests to produce the answer.

0 / 10 have requested this problem solution

The more requests, the faster the answer.

Request! (Login Required)


All students who have requested the answer will be notified once they are available.
Know the answer?
Add Answer to:
DNA fragments that are 500 bp, 1000 bp, and 2000 bp in length are separated by...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Similar Homework Help Questions
  • In rho-dependent transcription termination: the formation of a hairpin in the transcribed mRNA causes RNA polymerase...

    In rho-dependent transcription termination: the formation of a hairpin in the transcribed mRNA causes RNA polymerase to pause, facilitating termination. rho binds the mRNA, and when it makes contact with RNA polymerase, it assists with the removal of the mRNA from the DNA template. the rho factor binds to the -10 consensus sequence located in the promoter region to terminate transcription. a site within the poly(A) tail is cleaved which signals termination. the 3' untranslated region (3" UTR) is synthesized....

  • the following Sequence of DNA was mixed with an unknown primer of length 15 BP, ddC, the four NTPs and DNA polymerase. the resulting mixture of DNA fragments were separated to provide fragments of...

    the following Sequence of DNA was mixed with an unknown primer of length 15 BP, ddC, the four NTPs and DNA polymerase. the resulting mixture of DNA fragments were separated to provide fragments of lengths 23, 24, 28, and 32 BP amongst others (other fragments were observed but are not indicated). indicate below the sequence of the 15 bo primer from 5' to 3'. please explain how to do this d) The following sequence of DNA TTGCTCGACTGGACCTCACTGACACGA TCGCA TCCTTCGACTCGT was...

  • on the me but not with the larger fragments on o t and more and record...

    on the me but not with the larger fragments on o t and more and record med in the h 3. Determine the distracted for each bund data bere 4. Determine the distance traveled for each and generated in the double digest and record data bere tion Endonuclease Digestion and Gel Electrophoresis of DNA 185 VI. RESTRICTION MAPPING The different DNA fragments generated by different map DNA. For example, specific DNA on 2000 nucleotides in las Rl or Hind and...

  • - BamHI Ecort 4000 400 EcoRI 5kb 100 2000 I Target region of 770 bp in...

    - BamHI Ecort 4000 400 EcoRI 5kb 100 2000 I Target region of 770 bp in length has been amplified Plan to digest the DNA amplican with restrictich enzyme Egel, and done the resulting longest fragment into Eael site of 5 KB plasmid. 4. You now run the four RE digests of the recombinant plasmid from question (4) on an agarose gel and stain it with ethidium bromide (EtBr). Indicate your expected profile on the gel below. Clearly indicate the...

  • Put these DNA fragments in order of their position after gel electrophoresis, starting with the one...

    Put these DNA fragments in order of their position after gel electrophoresis, starting with the one closest to the negative end of the gel and ending with the one closest to the positive end of the gel. 73 bp 42 bp 100 bp 25 bp

  • Gel electrophoresis separates DNA fragments according to the sequence of their bases. their length. the number...

    Gel electrophoresis separates DNA fragments according to the sequence of their bases. their length. the number of mutations they carry. differences in electrical charge.

  • 9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA...

    9. On Worksheet 16.IIIB is a restriction map of bacteriophage lambda. You digest some lambda DNA with the enzymes BamHI and HindIII separately and then load the fragments into an agarose gel and perform electrophoresis. Next, you perform a Southern analysis using the 4,878-bp EcoRI lambda fragment as a probe. a. Draw a picture of the electrophoresis gel, using the outline of the stained electrophoresis gel in Worksheet 16.IIIB (the two smallest HindIII fragments will run off the gel.) b....

  • One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the...

    One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...

  • Part D Gel Electrophoresis and DNA All of the DNA fragments will be in charge, migrate...

    Part D Gel Electrophoresis and DNA All of the DNA fragments will be in charge, migrate toward the differences in and separate from one another due t Choose one answer from below. negative; cathode; size negative; anode; charge negative; anode; size positive; cathode; size positive; cathode; charge Submit Request Answer Incorrect; One attempt remaining; Try Again

  • NA fingerprinting uses a process called gel electrophoresis to separate the fragments of DNA. Once the...

    NA fingerprinting uses a process called gel electrophoresis to separate the fragments of DNA. Once the DNA fragments are sorted, the pattern of bands can be analyzed. 1)Gel Electrophoresis Procedure The smaller DNA fragments start to move away from the wells and the larger DNA fragments remain closer to the wells. 2)An electric current is passed through the gel. 3) DNA fragments are treated with a dye. 4)A restriction endonuclease is added to the DNA. 5)Using micropipettes, the DNA samples...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT