Question

Below is the sequence of a synthetic promoter called J23114 that functions with low efficiency in E. coli. The start site for transcription (+1) is the underlined C. TTTATGGCTAGCTCAGTCCTAGGTACAATGCTAGC 1. The six-base-35 and -10 regions are highlight in the promoter. What is the consensus sequence for these two regions? Indicate how many mismatched bases J23114 has for each. -35 consensus sequence = Number of mismatches: -10 consensus sequence = Number of mismatches: 2. What are the functions of the -35 and -10 Regions? What do you expect would be the effect on transcription of mutations in either or both of the -35 and -10 Regions of the promoter? -35 function = -10 function = 2. DNA can be mutated in any of several ways. A single base can be changed (point mutation), or one or more bases can be removed (deletion mutation) or added (insertion mutation). Suggest two specific mutations of the J23114 promoter that could help us to understand how it functions. Indicate the mutations on the J23114 sequence above. Mutant sequence #1: Mutant sequence #2:

Answer 1

1. -35 consensus sequence: TTGACA Number of mismatches: 3

-10 consensus sequence: TATTAT Number of mismatches: 2

2. The sigma regions 2 and 4 of the Sigma 70 factor recognizes and binds specifically to the -10 and -35 regions of the promoter. Therefore, these sites help in the docking of the polymerase for the initiation of transcription.

Effect of mutations:

Since the -35 region simply provides a more secure binding to secure polymerase to the promoter and the -10 region has a more elaborate role in the initiation of transcription because the DNA melting occurs in this region, therefore, a mutation in -10 sequence would be deleterious to the transcription of proteins whereas a mutation in -35 region would result in decreased levels of expression.