pUC19 vector is a commonly used cloning vector
Ori Purpose : Ori is the start point of DNA replication in Plasmids. Ori enables the plasmids to replicate and survive in the cells.
ampR Purpose : ampR means ampicillin resistance. Hosts like E.coli does not possess antibiotics resistance in nature. when Plasmids containing Ampicilin resistance is introduced into host via transformation, Only the Hosts containing Plasmids will show ampicillin resistance. Thus bacteria with plasmids in it can be easily screened using ampR screening
lacZ+ : lacZ+ gene is used to confirm the presence of gene of interest in the plasmid.
lacZ+ gene of the plasmid (Without gene of insert inserted into plasmid) and lacZ deletion mutant of the E.coli combines to give blue color to the colonies. lacZ+ gene contains restriction site. When gene of interest gets inserted into the lacZ+ using restriction digestion , lacZ+ gets disturbed. So it cannot produce blue color. Thus white colonies are formed. From this Blue/ White screening we can conclude that plasmids with gene of interest will produce white colony and plasmids without gene of interest will produce Blue colony.
Note : acZ+ gene of the plasmid (Without gene of insert inserted into plasmid) and lacZ deletion mutant of the E.coli combines to produce enzyme called β-galactosidase. β-galactosidase act on X-gal, a colourless analog of lactose to produce bright blue.I.e Blue colored colonies
Polylinker : Polylinker is also called Multiple Cloning site.It is a very short sequence of DNA with many unique restriction sites. This is the site where any gene of interest can be inserted without much trouble
When bacteria containing this plasmid are grown on media containing X gal and ampicliin, why do sometimes you see blue colonies and sometimes you see white colonies?
What does each type of colony tell us?
Let's assume that we are using E.Coli . When Plasmids with ampR is inerted into E.Coli , E.Coli will exhibit ampplicillin resistance. This is the reason for survival of bacteria in the presence of ampicillin. Whereas why do they produc e Blue color and white color?. It is because of the presence of X-gal, colourless analog of lactose. The lacZ+ gene of the plasmid (Without gene of insert inserted into plasmid) and lacZ deletion mutant of the E.coli combines to give blue color to the colonies. lacZ+ gene contains restriction site. When gene of interest gets inserted into the lacZ+ using restriction digestion , lacZ+ gets disturbed. So it cannot produce blue color. Thus white colonies are formed. From this Blue/ White screening we can conclude that plasmids with gene of interest will produce white colony and plasmids without gene of interest will produce Blue colony.
3. Below is a diagram of the pUC19 cloning vector (plasmid): Sall EcoRI Hinc Il Kpnl...
QUESTION 11 a) The diagram below shows a typical plasmid cloning vector. There are three components ORI, amp and restriction enzyme recognition sizes. Explain the roles of each of these three components and explain why each is important for cloning genes. 6 marks] ORI Hindlll Sphl Pstl Sall Restriction Sites Xbal BamHI Smal Kpnl Sac EcoRI amp ORI role: importance: amp role: importance: Restriction sites role: importance: b) A technique called RT-PCR uses the enzyme reverse transcriptase (RT) in combination...
You are tasked to clone the human actin gene (blue) from a cDNA clone that you obtained from a collaborator into the cloning vector termed pUC119 using the HindIII restriction enzyme. The 4 blue arrows show the HindIII recognition sequence on the Actin cDNA clone. Plac MCS Hindill Sphl sbil Pst BspMI Accl Hincli Sall Xbal BamHI Smal Xmal Acc651 Kpnl Eco53ki Sacl EcoRI lacz pMB1 ori M13 IG PUC119 3162 bps CDNA Clone Amp a. b. Figure 2: a....
A student clones a DNA fragment into the Sall site of pBR322. Sall is a restriction enzyme and pBR322 is the name of a plasmid (diagram below). Predict the media on which she could expect growth of E. coli containing the recombinant plasmid. Explain your answers. (16 pts) 2. EcoRI BamHI Pst Sall Ampicillin Tetracycline resistance (AmpR) resistance (TetR) pBR322 (4,361 bp) Origin of replication (ori) Pvull Media nutrient agar with ampicilin nutrient agar with tetracycline nutrient agar with ampicillin...
The extracted plasmid DNA is pUC19. Look up the plasmid map and
include in your pre-lab as well as your report.
a. What is the location of the BamH1 restriction site? Xmn1
restriction site? (sequence location by number). How many of these
sites exist each?
b. If single digestions were performed (one restriction enzyme)
with BamH1 and Xmn1, respectively, how many fragments would form,
and what would be the sizes of each of these fragments?
c. If a double digestion...
4. The vector below is called PUC19. It has a Polylinker site, also called a multiple cloning site ( MCS) where a gene of interest can be added so bacteria can express it as protein. The sequence of the MCS is show with the location of the restriction sites. E Xbal Sail Se Sphi Hindill GAATTCGAGCTCGGTACCOGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGG SACK Smal 0 2500 lacza Polylinker 396-454 500 amp 2000 PUC19 2686 bp ori 1000 If you wanted to insert a gene into this...
2. (Multiple answers) A student is doing an experiment to insert the plasmid seen below into an E. coli bacteria. They cut their plasmid and gene of interest with the HIND III restriction enzyme to insert their gene of interest. lacz HindIII BamHI -EcoRI amp PUC19 After the experiment is complete they observe many blue colonies on their plate media that contained nutrients, X-gal and ampicillin. Please choose all that are TRUE about this experiment. ampicillin is the selective ingredient...
If the target DNA (the 3.266 Kb E. coli genomic Bam HI fragment)
has the same restriction sites on each end, there are two possible
orientations for the target DNA to insert into the plasmid. The
following restriction enzymes would cut the 3.266 kb Bam HI genomic
fragment containing the RecA gene once or twice or not at all. In
the tables below, list the expected DNA fragment sizes for the two
possible orientations. Round the DNA fragment sizes to...
This is what I was given to solve the question. Nothing else and
I don't understand anything at all.
5. You are tasked to clone the human actin gene (blue) from a cDNA clone that you obtained from a collaborator into the cloning vector termed pUC119 using the HindIII restriction enzyme. The 4 blue arrows show the HindIII recognition sequence on the Actin cDNA clone. piac CS Hindi Sphi Sofi Psti BspMI Aocl Hincll Sall Xhal BamHI Smal Xmal Acc651...
Chromosomal and plasmid DNA can be cut into manageable pieces by
restriction enzymes. Using agarose gel electrophoresis, the DNA
fragments can be separated on a gel, based on their lengths. In
order to see the fragments, a stain is typically added to the gel.
The size of each fragment can be determined by comparing each one
to a DNA molecular weight marker of known size.
Below is a map of pBR22 plasmid. The position and base pair
number of the...