Question

Briefly outline the modifications that are made to the 5’ and 3’ ends of a primary...

Briefly outline the modifications that are made to the 5’ and 3’ ends of a primary transcript of one of your own genes.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

In EUKARYOTES the nucleus contains atleast three RNA polymerases in addition to the RNA polymerase found in the organelles.

The RNA polymerase-1 transcribes rRNAs{28S,18S,5.8S}

The RNA polymerase-2 transcribes the heterogenous nuclear RNA(hnRNA)

The RNA polymerase-3 is responsible for trancription of tRNA,5srRNA,snRNAs

In the process of transcription at the 5 prime end and at 3 prime end of the gene there are some steps taking place.They are CAPPING,RNA SPLICING and POLYADENYLATION{TAILING} to form messenger RNA.

The complexity is that the primary transcripts of eukaryotes contain both EXONS and INTRONS and are non-functional.Therefore the gene is subjected to a process called SPLICING.

In the process of splicing the introns are removed and exons are joined in a defined order.

The hnRNA undergoes additional process called CAPPING and TAILING.

In capping- an unusual nucleotide METHYL GUANOSINE TRIPHOSPHATE is added at the 5 prime end of hnRNA

In tailing -adenylate residues are added at the 3 prime end of hnRNA ,now called as mRNA, which is transported to nucleus for TRANSLATION.

Add a comment
Know the answer?
Add Answer to:
Briefly outline the modifications that are made to the 5’ and 3’ ends of a primary...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Outline briefly three (3) strengths and three (3) weaknesses of the Utilitarian theory

    Outline briefly three (3) strengths and three (3) weaknesses of the Utilitarian theory

  • Draw a typical prokaryotic gene with its promoter and terminator. Draw the primary transcript Label (using...

    Draw a typical prokaryotic gene with its promoter and terminator. Draw the primary transcript Label (using letters) all the parts (including sites of consensus sequences) in both the gene and the mRNA. Indicate what the ‘letters stand for. (Use the line drawing below). What proteins are involved in transcription initiation, elongation and termination in prokaryotic genes. +1 5’ ________________________________________________________________ 3’ 3’ ________________________________________________________________ 5’

  • 1. Label the template and coding strand. Label upstream and downstream ends.

    1. Label the template and coding strand. Label upstream and downstream ends.2. On the template strand identify the promoter.3. Identify the start site.4. Block off and number the triplets to be transcribed.5. Create the pre-mRNA. Label 5’ and 3’ ends.6. Using the codon table for mRNA (genetic dictionary), identify the start and stop codons.7. Identify the utrs (untranslated regions).8. Add a 5’ cap to the 5’ end of the mRNA transcript and a poly-A-tail to the 3’ end.9. Block off...

  • Using the same 3-4 business ideas from Week 3, outline which of the three primary forms...

    Using the same 3-4 business ideas from Week 3, outline which of the three primary forms of organization are appropriate for each. Why? What are the costs and benefits of each form of organization based on your proposed business idea? My three ideas are: 1) Voice Translator 2) Online Record Label 3) Blackhead Removal

  • 5 (4 pts). Briefly differentiate between PRIMARY and QUATERNARY structure in proteins, 6. (5 pts) Define...

    5 (4 pts). Briefly differentiate between PRIMARY and QUATERNARY structure in proteins, 6. (5 pts) Define the Damköhler number. Briefly explain why this number is important. (variables are OK-if you use any define them! the definition should be expressed as a phrase)

  • Sequence 1: 5' TAGGTGAAAGAGTAGCCTAGAATCAGTTA 3' Sequence 2: 5' TAACTGATTTCTTTCACCTA 3' a. Which sequence is the genomic...

    Sequence 1: 5' TAGGTGAAAGAGTAGCCTAGAATCAGTTA 3' Sequence 2: 5' TAACTGATTTCTTTCACCTA 3' a. Which sequence is the genomic fragment and which is the cDNA fragment? b. Write the RNA-like strand of the genomic sequence and indicate the 5' and 3 ends. Draw vertical lines between the bases that are the exon/ intron boundaries (Refer to the figure below for splice junction sequences.) (a) Short sequences dictate where splicing occurs. 30 nucleotides Exon 1 5' Intron Exon 2 3' Pu Pu GUPu Pu...CACUGAC...

  • 3. (4 points) Briefly describe the path a protein made by ribosomes that are attached to...

    3. (4 points) Briefly describe the path a protein made by ribosomes that are attached to the endoplasmic reticulum will follow through the endomembrane system in order to be exported from the cell. Include in your answer which other organelles the protein will move through, how the protein is moved from one organelle to another, and the process that a cell would use to export the protein. 4. Fill in the diagram below with what you learned about the cell...

  • (a) State three (3) mechanisms adopted by petals in attracting pollinators (b) Briefly discuss the role...

    (a) State three (3) mechanisms adopted by petals in attracting pollinators (b) Briefly discuss the role of human in ecosystem disruption. (c) State the differences between epiphytes and parasites (a) Flowers are made up of four (4) basic parts. Name them and briefly explain their functions (b) Why is interaction between angiosperm and pollinators considered mutualistic? (c) Outline 5 functions of the kidney. eas la Sepalalal crion wea8te Uea

  • Carvas X CO Inactivation of a specific transcription factor Modifications to the RNA transcript OPresence of...

    Carvas X CO Inactivation of a specific transcription factor Modifications to the RNA transcript OPresence of repressor protelns to reduce transcription Question 8 10pts The following lists many forms in which gene expression ls regulated in Eukaryotes. Which of those is common to both prokaryotes and eukaryotes? Tight colling of the DNA around histone proteins, making it inaccessible to RNA polymerase Protecting the mRNA by adding a 5 G-cap and 3 poly A tal O Repulating the availablity of transcription...

  • Q1 In your own words, provide an official definition of Network Management (NM) and briefly discuss...

    Q1 In your own words, provide an official definition of Network Management (NM) and briefly discuss an example (other than IT) than can best support your definition (refer to the book’s example/analogy). Answer: Q2 List the different entities that have an interest in NM and discuss their concerns from the perspective of their business model. Answer: Q3 Outline all major challenges facing NM and briefly discuss each one of them. Answer: Q4 Provide one and only one example of a...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT