Question

Draw a typical prokaryotic gene with its promoter and terminator. Draw the primary transcript Label (using...

Draw a typical prokaryotic gene with its promoter and terminator. Draw the primary transcript Label (using letters) all the parts (including sites of consensus sequences) in both the gene and the mRNA. Indicate what the ‘letters stand for. (Use the line drawing below). What proteins are involved in transcription initiation, elongation and termination in prokaryotic genes.

+1

5’ ________________________________________________________________ 3’

3’ ________________________________________________________________ 5’

0 0
Add a comment Improve this question Transcribed image text
Know the answer?
Add Answer to:
Draw a typical prokaryotic gene with its promoter and terminator. Draw the primary transcript Label (using...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 6. In the drawings below note and label all important elements (incl.consensus sequences) discussed in lectures...

    6. In the drawings below note and label all important elements (incl.consensus sequences) discussed in lectures and tutorial manual and listed below. Prokaryotis operon promoter (-10 and -35 elements), operator, multiple structural renes (for example 3), start site of transcription, start sites of translations, transcription termination sequence Prokaryotic mRNA (polycistronie): transcription start site, multiple ribosome binding sites The Shine-Dalgamo sequence in Ecoli), multiple ORFs (including start and stop codons). transcription termination sequence Eukaryotic genes promoter (TATA box), consensus sequence CAAT,...

  • 1. Describe the three stages in transcription in prokaryotes and note the functions of the enzymes...

    1. Describe the three stages in transcription in prokaryotes and note the functions of the enzymes that are involved for each. 2. Describe three ways in which transcription in in eukaryotes is different from that of prokaryotes. 3. At what stage of transcription do these alterations take place in? Initiation, Elongation or Termination? 4. Draw a prokaryotic gene with the following features: a. A promoter region with -35 and -10 consensus sequences. b. The start point of transcription with first...

  • 4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is...

    4. The non-template strand sequence of a eukaryotic gene is given below. The promoter sequence is underlined. The +1 nucleotide is shown in boldface and red. a. Write the sequence of the mRNA that would be produced by this gene. You may assume that the gene ends at the end of the sequence shown, so you do not need to look for transcription termination signals. You may also assume that it has no introns 5' GCGGTATAACAGGACAGGCTGCATGAGAAGATTCCATCTTCCAGATCACTGTCCTTCTAGCCATGGAAAATGA CGAATTGTGACTGCCCCTGC3' mRNA (make sure...

  • 3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic...

    3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic gene expression in comparison. Fill in the blank using PPT slides, notes and the textbook. Prokaryotic gene expression Eukaryotic gene expression Overview Steps Transcription and translation Yes Transcription and translation coupled? Gene structure No introns Epigenetic modification (chromosome remodeling) transcription, translation, RNA processing, protein processing Transcription in the nucleus and translation in the cytoplasm Interrupted gene with exons and introns RNAPI, II, III Which...

  • I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions....

    I. Use the DNA sequence below, which encodes a prokaryotic gene to answer the following questions. 11 21 31 41 51 71 81 61 91 CGTAATTGAG GAGGTAGTTG ACGTATGAAT AGTTAACGTA CGGGGGGGAA 101 111 121 131 141 ACCCCCCCTT TTTTTTTTTC GAGCAATAAA AGGGTTACAG ATTGCATGCT a) Write down the corresponding sequences, find them in the sequence above and label them: -35 Consensus sequence: _(label as -35) -10 Consensus sequence (Pribnow box): _ __ (label as Pribnow) Shine-Dalgarno sequence in corresponding mRNA: __ (label as SD)...

  • There are some significant differences in how transcription is regulated in prokaryotes like E. coli versus...

    There are some significant differences in how transcription is regulated in prokaryotes like E. coli versus eukaryotes. Which of the following statements concerning gene regulation is TRUE only in eukaryotes? (CHOOSE ALL THAT APPLY AND NO INCORRECT ANSWERS) The promoter of a gene can act in a position and distance-independent manner. The genes involved in one process are usually situated next to each other in the genome and are transcribed in one mRNA. The default state of gene transcription is...

  • on and 6. Draw the same Eukaryotic transcript after splicing has removed the m label the...

    on and 6. Draw the same Eukaryotic transcript after splicing has removed the m label the remaining parts. 7. Describe the roles of the following features involved in Eukaryotic transcription: TATA Binding Protein General Transcription Factors Polymerase II 8. In Eukaryotic transcription, which happens first? A. The General Transcription Factors are recruited, and the Preinitiation complex (PIC) is assembled. B. The TBP binds the promoter 9. Describe the carboxy terminal domain (CTD) of RNA polymerase II and two of its...

  • Question 8 (1 point) The primary RNA transcript of the chicken ovalbumin gene is 7700 nucleotides...

    Question 8 (1 point) The primary RNA transcript of the chicken ovalbumin gene is 7700 nucleotides long, but the mature mRNA that is translated on the ribosome is 1872 nucleotides long. This size difference occurs primarily as a result of: O addition of the poly A tail O removal of exons O splicing O addition of the 5' cap Question 7 (1 point) Which of the following recognizes the promoter region of a gene in E. coli allowing RNA polymerase...

  • A) Explain lagging strand DNA replication in detail. Underline the following terms in your answer: replication...

    A) Explain lagging strand DNA replication in detail. Underline the following terms in your answer: replication fork, DNA polymerase III, primase, and ligation. Make sure that your answer is complete and that all the entities that come together in the process of lagging strand replication are clearly explained. Draw one figure of a replication fork with the polarity (directionality) of each DNA strand indicated. G) Explain RNA transcription in E. coli in detail, from initiation to termination. Underline the following...

  • 22. What are the roles of Dicer and RISC in the function of miRNAs? Dicer RISC...

    22. What are the roles of Dicer and RISC in the function of miRNAs? Dicer RISC 23. Describe the concepts of primary, secondary, tertiary and quaternary protein structure 24. Here is a short sequence of codons. AUG CAU UGU UUU Write out the amino acids this sequence of codons encodes. Now add an insertion mutation of your choosing in the first codon and write out the new mutant sequence. What are the first four amino acids encoded by this mutant...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT