If in a gene an ACG codon is mutated due to exposure to an alkylation reagent, what mutagenized codons can occur?
The alkylating agents are the ones that add an alkyl group to the molecule it is acting on. If the alkylating agent acts on the nucleic acids, then they result in mispairing between the bases.
For Example - EMS is one of the alkylating agents that after acting upon a nitrogenous base guanine changes it into 6 - ethylguanine. Now, this leads to mispairing i.e. when guanine was normal it would pair with cytosine but after alkylation, it would pair with thymine.
Similarly, in the case of the codon ACG, if it is mutated by alkylating agent EMS, the complementary sequence of ACG would be TGT, which without mutation should have been TGC. Further, if other alkylating agents are used it may also give other results.
If in a gene an ACG codon is mutated due to exposure to an alkylation reagent,...
8: Due to the exposure of a cell to an environmental factor, a gene that was in a euchromatin region ends up being tightly wrapped around a histone. What will be the consequence of this event?
3 attempts left Check my work An essential gene has the codon 5-UUA-3' in a critical position. If this codon is mutated to the sequence 5-UUG-3', what is the expected consequence for the cell? Select all that apply. This change results in a positive mutation. The primary sequence of the protein would not be changed. The primary sequence of the protein would be changed. @ This change results in a silent mutation. This change results in a negative mutation.
If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually changes the amino acid coded for, but changes to the 3rd "letter" rarely do, roughly what % of mutations should be synonymous? Second АТ G UUU Phe UCU Ser UAU Tyr UGU Cys U 0 C | Phe UCC Ser UAC Tyr UGC Cys C Leu UCA Ser UAA Stop UGA Stop UUG Leu UCG Ser UAG Stop UGG Trp G CUU Leu CCU...
4. A study was conducted to estimate the prevalence of mutated gene among residents of a town neighbouring a nuclear reactor. Two hundred and twenty-eight of out 1000 subjects tested positive for some form of mutation. a) Determine a 99% confidence interval to estimate the prevalence of this mutation. 141 b) What information does the interval in (a) convey? [1] c) What sample size would be required for the researcher to estimate the true prevalence rate, such that he/she can...
What is a gene? Describe the function, structure, and location within the cell. What are the three stop codons? What is the start codon? Compare and contrast bacterial and eukaryotic ribosomes. Do a web search to find another example of a disease caused by a mutation in a single gene. Do the resulting symptoms (new trait) make sense considering the role of the affected protein? Why or why not? Transformation, conjugation, and transduction were discovered in the laboratory. How important...
PROBLEM SET #3 MAKEUP DUE: If a gene is cloned and then expressed in vitro (via a coupled transcription/translation system) the expectation is that a single polypeptide will be observed when analyzed by SDS Page (e.g., at 60KD in lane 1). Furthermore, if a premature stop codon were engineered 83% of the way down the gene, then protein synthesis would stop prematurely and a single polypeptide would be expected at 50KD (lane 2). 60kD 50kD 40kD 30kD In a number...
4. A man makes 0 units of an enzyme due to homozygous recessive gene on chromosome 21. He marries a woman who produces 100 units of the same enzyme due to the heterozygous pairs of genes on her chromosomes 21. Their firstborn son has three copies of chromosome 21 and produces 200 units of the enzyme mentioned above. a) In which parent did the nondisjunction occur? b) Did the nondisjunction occur in meiosis I, meiosis II or mitosis? c) What...
4. A man makes 0 units of an enzyme due to homozygous recessive gene on chromosome 21. He marries a woman who produces 100 units of the same enzyme due to the heterozygous pairs of genes on her chromosomes 21. Their firstborn son has three copies of chromosome 21 and produces 200 units of the enzyme mentioned above. a) In which parent did the nondisjunction occur? b) Did the nondisjunction occur in meiosis I, meiosis II or mitosis? c) What...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
63. In cancer cells one allele of the tumor suppressor gene p53 is frequently mutated so that the protein is inactive, not produced, or deleted. The other allele will usually … promoter remains intact but the gene is not expressed. Sequencing with sodium bisulfite modification of DNA can be used to detect which cytosines are methylated. …what would be the anticipated results? Cytosines in or near the promoter region will be methylated Cytosines in or near the promoter will not...