Question

Which of the following is NOT a characteristic of a double-stranded DNA helix. Question 22 options:...

Which of the following is NOT a characteristic of a double-stranded DNA helix.

Question 22 options:

The width of the helix is 20 Angstroms.

Bases are separated by 10 Angstroms.

The length of one helical turn is 34 Angstroms.

All these statements are true.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Which of the following is not a characteristic of a double stranded DNA helix

THE CORRECT ANSWER IS D) ALL THESE STATEMENTS ARE TRUE

Dimensions of DNA

The diameter aur width of DNA molecule is 2nm or 20 angstroms. When DNA molecule makes 1 complete 360 degree turn, it covers a distance of 3.4nm or 34 angstroms. There are 10base pairs in 10 angstroms.

Add a comment
Know the answer?
Add Answer to:
Which of the following is NOT a characteristic of a double-stranded DNA helix. Question 22 options:...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • On a planet other than earth, an organism has DNA with a left handed double helix...

    On a planet other than earth, an organism has DNA with a left handed double helix with a rise of 0.61 A and a helical pitch of 9.76 A. When the DNA wraps around a histone 181 bases of DNA surround the histone and each nucleosome is separated by 121 bases of DNA. How many bases are found in a single pitch ( one turn of DNA ) ?

  • Draw the DNA double helix as proposed by Watson and Crick in their famous 1953 paper....

    Draw the DNA double helix as proposed by Watson and Crick in their famous 1953 paper. On this drawing, indicate the locations of the following:      the ribose-phosphodiester backbone the base pairs the 5' and 3' ends of the two strands the number of base pairs in one complete turn of the helix the length of 1 complete turn of the double helix (in Angstroms or nanometers)

  • Select the phrases that accurately describe properties of the most common form of the DNA double helix

    Select the phrases that accurately describe properties of the most common form of the DNA double helix. There is more than one correct answer. Select all that apply. DNA contains equal amounts of adenine and thymine, and equal amounts of cytosine and guanine. A helical turn consists of about 10 nucleotides. Base pairs have a spacing of 20 A. The phosphodiester bonds between nucleotide residues run in opposite directions in the two strands. The nitrogenous bases are exposed to the solvent, whereas the sugar-phosphate backbone of...

  • 6a. Dissociation of the double stranded DNA helix into single coils is referred to as DNA...

    6a. Dissociation of the double stranded DNA helix into single coils is referred to as DNA melting. In this process, two strands of a DNA molecule can be separated by heat without breaking any covalent bonds. Every unique DNA molecule “melts” at a different temperature. Determine the order of the DNA sequences listed below according to relative melting temperatures (lowest Tm to highest Tm). Assume that they all begin as stable double-stranded DNA molecules. [3 pts] A. CTGAATCA B. CAGTGTCT...

  • Which of the following statements is true regarding the discovery of the double helix? Choose 1...

    Which of the following statements is true regarding the discovery of the double helix? Choose 1 answer: (A) It was discovered that double-stranded DNA is a parallel molecule. Rosalind Franklin's x-ray crystallography provided Watson and Crick with important data that helped determine the structure of DNA. The experiments that led to the discovery of the double helix ultimately disproved Chargaff's rules regarding nitrogenous bases. James Watson, Francis Crick, Maurice Wilkins, and Rosalind Franklin were awarded the Nobel Prize in Medicine...

  • Sketch the diffraction pattern you would expect to see for the following DNA molecules: (a) DNA...

    Sketch the diffraction pattern you would expect to see for the following DNA molecules: (a) DNA isolated from humans, (b) Martian DNA, which is a double stranded DNA molecule with a 1⁄4 offset and 8 bases per turn, and (c) Jovian DNA, which is single stranded DNA molecule with 6 bases per turn. You only need to sketch the diffraction above the direct x-ray beam (i.e. the top half of the X due to the helix). Your sketch should extend...

  • QUESTION 11 Which is true of the structure the DNA double helix? A. The sugar-phosphate backbone...

    QUESTION 11 Which is true of the structure the DNA double helix? A. The sugar-phosphate backbone faces outward. B. The nitrogen-containing bases face inward and form hydrogen bonds to one another. C. Adenine (A) bonds to Thymine (T). D. Adenine (A) bonds the Cytosine (C).

  • What is the angle of the turns of DNA? What length in Å (Angstrom) would be...

    What is the angle of the turns of DNA? What length in Å (Angstrom) would be DNA with 23 chromosomes in the sex cells? If p = 34 Å how many angstroms would you estimate is the length of the hydrogen bond? Interpretation of crystallograph 17h 01/p IP sin = n2/20 - tilt of helix (angle from perpendicular to long axis) - 3.4 A (Distance between bases) P = 34 Å (Distance for one complete turn of helix; Repeat unit...

  • In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA...

    In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT

  • QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3'...

    QUESTION 34 The nucleotide sequence of one DNA strand of a DNA double helix is 5-GGATTTTTGTCCACAATCA-3' What is the sequence of the complementary strand? A. 5-CCTAAAAACAGGTGTTAGT-3 B.3.CCUAAAAACAGGUGUUAGU-5 C.3-CCTAAAAACAGGTGTTAGT-5 D. None of these QUESTION 35 In the DNA of the spinach chloroplast, 31% of the nitrogenous bases are adenine (A). What are the percentages of the other bases? A. 25% G, 25% C, 19% T B. 19% G, 19% C, 31% T C.31% G, 19% C, 19% T D.31% G, 31%...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT