Foreign DNAs are inserted into a vector at a region called the? a. Anchor point b. Multiple Cloning Site c. Origin of replication d. Resistance gene e. Promoter region
c should be the correct option
Foreign DNAs are inserted into a vector at a region called the origin of replication, An origin of replication is a sequence of DNA at which replication is initiated on a chromosome, plasmid or virus.
HOPE MY ANSWER HELP YOU
ALL THE BEST
Foreign DNAs are inserted into a vector at a region called the? a. Anchor point b....
An ideal cloning vector contains all of the following, EXCEPT an origin of replication. O Ob a gene encoding resistance to an antibiotic. a gene encoding reverse transcriptase. O a multiple-cloning site. O e the lacZ gene (or a variation thereof).
Which of the following characteristic is not present in a plasmid on a general basis?a) Multiple cloning site (MCS)b) Origin of replication (ori)c) Antibiotic resistance gened) Beta galactose genes
4. The vector below is called PUC19. It has a Polylinker site, also called a multiple cloning site ( MCS) where a gene of interest can be added so bacteria can express it as protein. The sequence of the MCS is show with the location of the restriction sites. E Xbal Sail Se Sphi Hindill GAATTCGAGCTCGGTACCOGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGG SACK Smal 0 2500 lacza Polylinker 396-454 500 amp 2000 PUC19 2686 bp ori 1000 If you wanted to insert a gene into this...
Outline the steps required to close a eukaryotic gene using E. coli from mRNA derived from cells expressing the gene. Include how you would amplify the specific gene and how you would select for bacterial cells containing the cloned gene if the gene was inserted into a multiple cloning site within the lacZ gene on a plasmic. If you wanted to later express the gene using a eukaryotic expression vector and promoter how would you ensure the gene was in...
You wake up one morning to your roommate exclaiming about her sudden hair growth. She has been supplementing her diet with a strange new fungus purchased at the local farmer's market. You take samples of the fungus to your lab and you find that this fungus does indeed make a protein (the harE protein) that stimulates hair growth. You construct a fungal genomic DNA library in the hope of cloning the harЕ gene. If you succeed you will be a...
The basic structure of a gene contains which of the following? A) amino acids as specified by the DNA sequence B) an origin of replication C) a transcriptional termination site D) a promoter E) a site where sigma is released
1. An enzyme used to covalently join DNA segments to form recombinant DNA molecules is called a A. Restriction endonuclease B. Reverse transcriptase C. DNA polymerase D. Helicase E. Ligase 7. The procedure for introducing changes into specific genes is called A. An enhancer trap B. Imprinting C. RT-PCR D. DNA looping E. Gene targeting 2. Plasmids used for in vitro cloning of foreign DNA fragments are called A. Donors B. DNA chips C. Clones D. Vectors E. Conjugants 8....
1) Which one of the following would NOT be necessary for an expression vector? A) Transcription start site B) Selectable marker C) Cloning site D) Chromosome independent replication E) Antibody binding site 2)A virus that infects a prokaryotic cell is called a bacteriophage or phage. Which of the following mechanisms for introducing DNA into prokaryotic cells involves the use of phage as the vector? A) Conjugation B) Transduction C) Transformation D) Abrogation E) Importation 3)The use of epitopes like GST...
You successfully inserted a foreign piece of DNA, e.g. the gene for human erythropoetin (EPO), into a bacterial plasmid, which also contains a gene conferring antibiotic resistance to ampicillin. What is your next step you do on the way to finally produce the human hormone in E.coli? A) you cut the plasmid with restriction enzymes B) you grow E.coli on agar plates containing ampicillin C) you grow E.coli on agar plates containing tetracycline D) you insert...
The lightly stained region of DNA called: a. Heterochromatin b. Euchromatin c. Gene d. Exon ------------ Genes are coded massages written into enormously long molecules called: a. DNA b. RNA c. Polypeptide d. Polysaccharides -------------- Within DNA of human cell, only 75% represent codon. The function of the remainder are unknown. a. True b. False ---------- Function protein of genes sequences code for protein: a. Code b. Codon c. Exon d. Intron ---------- The 3 end of strand signified by...