Foreign DNAs are inserted into a vector at a region called the? a. Anchor point b....
Foreign DNAs are inserted into a vector at a region called the? a. Anchor point b. Multiple Cloning Site c. Origin of replication d. Resistance gene e. Promoter region
Homework Answers
c should be the correct option
Foreign DNAs are inserted into a vector at a region called the origin of replication, An origin of replication is a sequence of DNA at which replication is initiated on a chromosome, plasmid or virus.
HOPE MY ANSWER HELP YOU
ALL THE BEST
Add Answer to:
Foreign DNAs are inserted into a vector at a region called the?
a. Anchor point b....
An ideal cloning vector contains all of the following, EXCEPT an origin of replication. O Ob...
An ideal cloning vector contains all of the following, EXCEPT an origin of replication. O Ob a gene encoding resistance to an antibiotic. a gene encoding reverse transcriptase. O a multiple-cloning site. O e the lacZ gene (or a variation thereof).
Cloning using a Simple Plasmid and Alpha Complementation
Which of the following characteristic is not present in a plasmid on a general basis?a) Multiple cloning site (MCS)b) Origin of replication (ori)c) Antibiotic resistance gened) Beta galactose genes
4. The vector below is called PUC19. It has a Polylinker site, also called a multiple...
4. The vector below is called PUC19. It has a Polylinker site, also called a multiple cloning site ( MCS) where a gene of interest can be added so bacteria can express it as protein. The sequence of the MCS is show with the location of the restriction sites. E Xbal Sail Se Sphi Hindill GAATTCGAGCTCGGTACCOGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGG SACK Smal 0 2500 lacza Polylinker 396-454 500 amp 2000 PUC19 2686 bp ori 1000 If you wanted to insert a gene into this...
Outline the steps required to close a eukaryotic gene using E. coli from mRNA derived from...
Outline the steps required to close a eukaryotic gene using E. coli from mRNA derived from cells expressing the gene. Include how you would amplify the specific gene and how you would select for bacterial cells containing the cloned gene if the gene was inserted into a multiple cloning site within the lacZ gene on a plasmic. If you wanted to later express the gene using a eukaryotic expression vector and promoter how would you ensure the gene was in...
You wake up one morning to your roommate exclaiming about her sudden hair growth. She has...
You wake up one morning to your roommate exclaiming about her sudden hair growth. She has been supplementing her diet with a strange new fungus purchased at the local farmer's market. You take samples of the fungus to your lab and you find that this fungus does indeed make a protein (the harE protein) that stimulates hair growth. You construct a fungal genomic DNA library in the hope of cloning the harЕ gene. If you succeed you will be a...
The basic structure of a gene contains which of the following? A) amino acids as specified...
The basic structure of a gene contains which of the following? A) amino acids as specified by the DNA sequence B) an origin of replication C) a transcriptional termination site D) a promoter E) a site where sigma is released
1. An enzyme used to covalently join DNA segments to form recombinant DNA molecules is called...
1. An enzyme used to covalently join DNA segments to form recombinant DNA molecules is called a A. Restriction endonuclease B. Reverse transcriptase C. DNA polymerase D. Helicase E. Ligase 7. The procedure for introducing changes into specific genes is called A. An enhancer trap B. Imprinting C. RT-PCR D. DNA looping E. Gene targeting 2. Plasmids used for in vitro cloning of foreign DNA fragments are called A. Donors B. DNA chips C. Clones D. Vectors E. Conjugants 8....
1) Which one of the following would NOT be necessary for an expression vector? A) Transcription...
1) Which one of the following would NOT be necessary for an expression vector? A) Transcription start site B) Selectable marker C) Cloning site D) Chromosome independent replication E) Antibody binding site 2)A virus that infects a prokaryotic cell is called a bacteriophage or phage. Which of the following mechanisms for introducing DNA into prokaryotic cells involves the use of phage as the vector? A) Conjugation B) Transduction C) Transformation D) Abrogation E) Importation 3)The use of epitopes like GST...
You successfully inserted a foreign piece of DNA, e.g. the gene for human erythropoetin (EPO), into...
You successfully inserted a foreign piece of DNA, e.g. the gene for human erythropoetin (EPO), into a bacterial plasmid, which also contains a gene conferring antibiotic resistance to ampicillin. What is your next step you do on the way to finally produce the human hormone in E.coli? A) you cut the plasmid with restriction enzymes B) you grow E.coli on agar plates containing ampicillin C) you grow E.coli on agar plates containing tetracycline D) you insert...
The lightly stained region of DNA called: a. Heterochromatin b. Euchromatin c. Gene d. Exon ------------...
The lightly stained region of DNA called: a. Heterochromatin b. Euchromatin c. Gene d. Exon ------------ Genes are coded massages written into enormously long molecules called: a. DNA b. RNA c. Polypeptide d. Polysaccharides -------------- Within DNA of human cell, only 75% represent codon. The function of the remainder are unknown. a. True b. False ---------- Function protein of genes sequences code for protein: a. Code b. Codon c. Exon d. Intron ---------- The 3 end of strand signified by...
An ideal cloning vector contains all of the following, EXCEPT an origin of replication. O Ob a gene encoding resistance to an antibiotic. a gene encoding reverse transcriptase. O a multiple-cloning site. O e the lacZ gene (or a variation thereof).
4. The vector below is called PUC19. It has a Polylinker site, also called a multiple cloning site ( MCS) where a gene of interest can be added so bacteria can express it as protein. The sequence of the MCS is show with the location of the restriction sites. E Xbal Sail Se Sphi Hindill GAATTCGAGCTCGGTACCOGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGG SACK Smal 0 2500 lacza Polylinker 396-454 500 amp 2000 PUC19 2686 bp ori 1000 If you wanted to insert a gene into this...
You wake up one morning to your roommate exclaiming about her sudden hair growth. She has been supplementing her diet with a strange new fungus purchased at the local farmer's market. You take samples of the fungus to your lab and you find that this fungus does indeed make a protein (the harE protein) that stimulates hair growth. You construct a fungal genomic DNA library in the hope of cloning the harЕ gene. If you succeed you will be a...
1. An enzyme used to covalently join DNA segments to form recombinant DNA molecules is called a A. Restriction endonuclease B. Reverse transcriptase C. DNA polymerase D. Helicase E. Ligase 7. The procedure for introducing changes into specific genes is called A. An enhancer trap B. Imprinting C. RT-PCR D. DNA looping E. Gene targeting 2. Plasmids used for in vitro cloning of foreign DNA fragments are called A. Donors B. DNA chips C. Clones D. Vectors E. Conjugants 8....
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago