Question

PDB BLAST, NCBI BLAST, and KEGG all use E values to describe the sequences matching the...

PDB BLAST, NCBI BLAST, and KEGG all use E values to describe the sequences matching the query. How does the E value differ (if at all) between these programs? Explain your answer.

Throughout these lab exercises you have analyzed sequences using protein BLAST (pBLAST) through NCBI, the PDB, and KEGG. How do these BLAST programs differ from one another, if at all? Explain your answer.

0 0
Add a comment Improve this question Transcribed image text
Answer #1

The above equestion is from Bioinformatics field, where the science is linked with computer technology.

E- value is define as the number of expected hits of similar score or quality and it is found by chance, . the given sequence is purely by chance. the data base match is a result of homologous relationship.

PDB BLAST, NCBI BLAST, and KEGG all use E values to describe the sequences matchng the query. the E value may slightly differ or nit between these programs because E value depend on first quality filter and depend on the size of used databases. large databass increase the chances of false hits.

All these lab exercise that are that analyze sequences using protein BLAST (pBALST) through NCBI , THE PDB, and KEGG are differ from one another as have different databases so, they differ from each other slightly but not more on the basis of quantity of databases present in them.

Add a comment
Know the answer?
Add Answer to:
PDB BLAST, NCBI BLAST, and KEGG all use E values to describe the sequences matching the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an...

    Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F   5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R   5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...

  • x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1:...

    x Assignment 1 - Database.pdf ... Learn how to access and use NCBI databases Question 1: Search Taxonomy database for: 1) Homo sapiens, 2) Heterodoxus macropus, 3) E. coli. a. What is the common name of the species? b. How many nucleotide or protein sequence records do you find (show your search results in cropped windows)? Question 2: Use the name "plague thrips" to search the Nucleotide database. a. What is the scientific name of the plague thrips? b. How...

  • E-value for microbial computational genomics/genetics? Particularly need help with 1a, but if you can help with...

    E-value for microbial computational genomics/genetics? Particularly need help with 1a, but if you can help with any of the rest that would be great! Thanks in advance! 1. As discussed in the final computational lecture, PSI-BLAST' is an iterative multiple sequence alignment technique that starts with a single protein query of database search by pairwise alignment. The resulting pairwise alignments from that search are collated and analyzed to create a PSSM (position specific substitution matrix) which is subsequently used in...

  • Genes in eukaryotes are often organized into exons and intrans, which require splicing to produce an...

    Genes in eukaryotes are often organized into exons and intrans, which require splicing to produce an mRNA that can be translated. The gene organization is the order of the DNA segments that comprise the gene starting with the promoter, the first exon, the first intron, the second exon, and so on. The interspersed intrans can make gene identification difficult in eukaryotesparticularly in higher eukaryotes with many introns and alternative spliced mRNAs. Prediction of many genes and their organization has been...

  • erms Matching Match the key terms with their definitions. Write the key term letter by the...

    erms Matching Match the key terms with their definitions. Write the key term letter by the appropriate numbered definition k. Foreign key 1. Multitable query m. Nul a. AND condition b. Auto Number c. Caption property d. Cascade Delete Related Records e. Cascade Update Related fields f. Comparison Operator 8. Criteria row h. Data redundancy i. Data type 1. Field property o. OR condition p. Query q. Referential Integrity r. Simple Query Wizard 5. Wildcard Special character that can represent...

  • 3. (8 pts) Use EVERY possible term to describe the mutational differences between the two sequences...

    3. (8 pts) Use EVERY possible term to describe the mutational differences between the two sequences below (transition, transversion, point mutation, nucleotide substitution, deletion, insertion, frameshift mutation, nonsense, missense, synonymous, silent, non-synonymous.). There are many ways to describe each mutation. To get full points, use ALL the possible ways to describe each mutation from the list above. Mutations are in red at positions 09, 16, 23, and 35. 000 000 000 111 111 111 122 222 222 223 333 333...

  • (a) Identify all the amino acids from the structures below and use these structures to describe...

    (a) Identify all the amino acids from the structures below and use these structures to describe the meaning of the following in terms of protein structure; i. an intramolecular disulphide bond, "hydrophobic interaction”, iii. pH dependent electrostatic forces. а) соон yoon с) соон H.N—C—H H.N— C—H HNg–H | d) соон H,N—C—H CH2 SH CH, CH (b) Describe the process of protein denaturation and explain why high temperatures promote denaturation. Include a description of the role of protein denaturation in the...

  • values differ, give reasons as why they are different. ruct Table 2. Results of the Biuret...

    values differ, give reasons as why they are different. ruct Table 2. Results of the Biuret Test Color with Biuret Reagent Test Tube Contents Questions: 1) Which tubes contain protein? Describe a positive biuret test for protein based on your experimental results. the Rpomin Cole tor 丹 ts in proteins 2) Based on your qualitative (visual) observations of the Biuret test results, do all three tubes contain the same amount of protein? How do you know? 3) Explain method by...

  • 1. Describe one experiment that can test the hypothesis that DNA replication is semi conservative. Describe...

    1. Describe one experiment that can test the hypothesis that DNA replication is semi conservative. Describe the results of this experiment if replication was conservative. And if it was distributive? 2. What type of chemical bond contributes to the specificity of base paring in the DNA? Are there any other chemical or physical factors in the structure o f the DNA molecule contributing to the thermodynamic stability of the DNA? 3. List the m ajor differences between DNA and RNA....

  • please answer all the parts Supplemental Questions - Titration Lab, 1. Indicate how each of the...

    please answer all the parts Supplemental Questions - Titration Lab, 1. Indicate how each of the following would affect the values of K, for the weak acid unknown and for the dibasic salt and the value of the molar mass for the dibasic salt (Would the determined values be higher or lower than the actual values?). Use larger, smaller or no change. And as always....Explain. a. The titrant (either the NaOH or the HCI) molarity is actually HIGHER than that...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT