A. How did you prepare the template DNA? B. Name the gene that we will be...
A. How did you prepare the template DNA? B. Name the gene that we will be sequencing in order to identify the unknown. C. Explain why this region is considered to be the target for identification instead of sequencing the entire genome? D. What is the size (in bp) of target DNA in E. coli?
Homework Answers
Answer. For preparing the template DNA we use the whole genome extraction and uses specific primer so that it bind to that region and through PCR we can amplify that region .
B) 16s rRNA gene is sequence to identify the unknown.
C) This region is target for sequence because it is the conserved region in all the Prokaryotic cell. Mutation in this gene result in speciation.
D) The size of 16s rRNA gene is 1522 bp long.
Add Answer to:
A. How did you prepare the template DNA? B. Name the gene that
we will be...
Identification of unknown Bacteria by sequencing rDNA Having a little trouble understanding the PCR process. This...
Identification of unknown Bacteria by sequencing rDNA Having a little trouble understanding the PCR process. This is a lab we did and some homework questions regarding the sequencing rDNA to find unknown bacteria. I hope by answering these I can have better understanding of the process. The more descriptive the better. Thank you! 1. A. Name the gene that we will be sequencing in order to identify the unknown. Explain why this region is considered to be the target for...
This is for an a 3 unknown I am doing in Microbiology. And I don't quite...
This is for an a 3 unknown I am doing in Microbiology. And I don't quite understand it, if you could please help thanks A. How did you prepare the template DNA? B. Name the gene that we will be sequencing in order to identify the unknown. C. Explain why this region is considered to be the target for identification instead of sequencing the entire genome? D. What is the size (in bp) of target DNA in E. coli? B....
Identification of unknown Bacteria by sequencing rDNA Having a little trouble understanding the PCR process. This...
Identification of unknown Bacteria by sequencing rDNA Having a little trouble understanding the PCR process. This is a lab we did and some homework questions regarding the sequencing rDNA to find unknown bacteria. I hope by answering these I can have better understanding of the process. The more descriptive the better. Thank you! 2. A. List the reagents used in preparing master mix for PCR and write one sentence about why each one was necessary. B. Now that you have...
This is also for the Unknown 3 I am doing for microbiology. If you could please...
This is also for the Unknown 3 I am doing for microbiology. If you could please help in detail thanks. A. Now that you have confirmed that PCR product is of correct size, using agarose gel electrophoresis, how will you find out that the amplified DNA fragment is our desired target region? B. What is the principle of Sangers’ sequencing technique? Use a labeled diagram (may copy & paste image from internet) to briefly describe the technique. Write two differences...
1. The following DNA sequence was discovered in a metagenomic analysis of a soil sample. It...
1. The following DNA sequence was discovered in a metagenomic analysis of a soil sample. It is 249 bp long, and is suspected to be a serine protease inhibitor ATGAGCAGCGGCGGCCTGCTGCTGCTGCTGGGCCTGCTGACCTTTTGCGCGGAACTGACC CCGGTGAGCAGCCGCAAACGCCATCCGTATTGCAACCTGCCGCCGGATCCGGGCCCGTGC CATGATAACAAATTTGCGTTTTATCATCATCCGGCGAGCAACAAATGCAAAGAATTTGTG TATGGCGGCTGCGGCGGCAACGATAACCGCTTTAAAACCCGCAACAAATGCCAGTGCACC TGCAGCGGC a) Which sequencing method would you use to sequence a gene in this size range, and why? (Name of technique and 1-2 sentence explanation.) b) What technique would you use to amplify the DNA, in order to make more of it for future experiments? (What is...
Shown below is the anti-sense DNA sequence from a region of a gene that produces a...
Shown below is the anti-sense DNA sequence from a region of a gene that produces a specific protein. Mutations in this region of the gene cause a disease CTT TTA TAG TAG ATA CCA CAA AGG a. What is the mRNA strand that is transcribed from the DNA shown above? b. What is the amino acid sequence that would be translated from the mRNA strand you determined in part 1? c. If an individual has a G at position 15...
QUESTION 1: You are inserting a gene into an MCS found within the LacZ gene. Using...
QUESTION 1: You are inserting a gene into an MCS found within the LacZ gene. Using blue/white colony selection, why could you assume that white colonies have modified plasmids? a. A blue colony means the LacZ reading-frame was disrupted b. A blue colony means your gene has mutations c. A white colony means the LacZ reading-frame is intact d. A white colony means the LacZ reading-frame was disrupted QUESTION 2: You are performing a PCR using primers with a sequence perfectly...
1) You have two human liver cells (A and B) and you hypothesize that the insulin...
1) You have two human liver cells (A and B) and you hypothesize that the insulin receptor gene in Cell A has a mutation in exon 1 and Cell B contains the wild type sequence. You extract genomic DNA from each of the cells. Of the following, what would be the most efficient (quick, precise and relatively cheap) way to test your hypothesis. a. Isolate protein from both cells, purify the insulin receptor, and determine the amino acid content. b. Sequence the...
Please help me answering these multiple questions of how the CRISPR system works, thank you! 1....
Please help me answering these multiple questions of how the CRISPR system works, thank you! 1. Match the CRISPR component with its function. (matching the upper case letters to the lower case letters) A). Cas9 B). gRNA (sometimes called sgRNA) C). Non-homologous End Joining (NHEJ) D). Homology-directed Repair (HDR) a). A short RNA molecule that guides a DNA cutting enzyme to a specific location in genomic DNA. b). A type of DNA repair mediated by a set of enzymes all...
Protein P is synthesized in relatively high amounts in the human pancreas. This protein has been...
Protein P is synthesized in relatively high amounts in the human pancreas. This protein has been isolated and purified, but its amino acid sequence has not been determined. We wish to clone the gene for protein P. (a) How can a probe be prepared to identify the gene for protein P? (b) If we have prepared a radioactive messenger RNA as our probe in part (a), how could we verify that it is the mRNA for protein P? (c) If...
1. The following DNA sequence was discovered in a metagenomic analysis of a soil sample. It is 249 bp long, and is suspected to be a serine protease inhibitor ATGAGCAGCGGCGGCCTGCTGCTGCTGCTGGGCCTGCTGACCTTTTGCGCGGAACTGACC CCGGTGAGCAGCCGCAAACGCCATCCGTATTGCAACCTGCCGCCGGATCCGGGCCCGTGC CATGATAACAAATTTGCGTTTTATCATCATCCGGCGAGCAACAAATGCAAAGAATTTGTG TATGGCGGCTGCGGCGGCAACGATAACCGCTTTAAAACCCGCAACAAATGCCAGTGCACC TGCAGCGGC a) Which sequencing method would you use to sequence a gene in this size range, and why? (Name of technique and 1-2 sentence explanation.) b) What technique would you use to amplify the DNA, in order to make more of it for future experiments? (What is...
Protein P is synthesized in relatively high amounts in the human pancreas. This protein has been isolated and purified, but its amino acid sequence has not been determined. We wish to clone the gene for protein P. (a) How can a probe be prepared to identify the gene for protein P? (b) If we have prepared a radioactive messenger RNA as our probe in part (a), how could we verify that it is the mRNA for protein P? (c) If...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago