In the nuclease digestion experiment, the scientists use a technique called gel electrophoresis. While this is related to SDS-PAGE used in the separation of membrane proteins, it is NOT THE SAME thing. From the list below, choose all the ways that gel electrophoresis is done for nuclease digestion is different from the gel electrophoresis in SDS-PAGE.
Group of answer choices
1.Used to separate DNA or RNA.
2.Used to separate proteins.
3.Prteins and DNA must be separated prior to running the gel (in addition to any digestion treatments).
4.Only the pretein is loaded into the gel.
5.Sample needs to be pre-treated with SDS, so that it has a uniform negative charge.
6.Gel is made of agarose.
7.Gel is made of polyacrylamide.
8.SDS is not required, as sample already carries a uniform negative charge.
9.Proteins and DNA must be separated prior to running the gel (in addition to any digestion treatments).
10.Only the DNA is loaded into the gel.
sodium dodecyl sulfate-polyacrylamide gel electrophoresis or SDS PAGE is a protein separation method where proteins are separated based on their molecular masses. SDS is a detergent which denatures proteins and therefore, proteins take linear appearance. Also, SDS provides a uniform negative charge to the sample proteins. Polyacrylamide is used as it is easy to handle and pore size can be controlled easily. It works like a mesh containing many holes through which proteins run from negative to the positive side of the apparatus.
But in agarose gel electrophoresis, as DNA is already negative, no SDS treatment is needed.
In both cases, protein and DNA need to be separated before running the gel.
The answer choices grouped for SDS PAGE and agarose gel electrophoresis is given below.
SDS PAGE-------
2.Used to separate proteins.
3. Proteins and DNA must be separated prior to running the gel.
4. Only the protein is loaded into the gel.
5. Sample needs to be pre-treated with SDS.
7. Gel is made of polyacrylamide.
AGAROSE GEL ELECTROPHORESIS-----------
1. Used to separate DNA or RNA.
6. Gel is made of agarose.
8. SDS is not required, as sample already have uniform negative charge ( as DNA or RNA is negatively charged molecules).
9. Protein and DNA must be separated prior to running the gel.
10. Only DNA is loaded into the gel.
In the nuclease digestion experiment, the scientists use a technique called gel electrophoresis. While this is...
Gel electrophoresis. Polypeptides can be separated by electrophoresis according to their relative content of acidic and basic residues. The isoelectric point (pI) of a polypeptide is the pH at which its net charge is zero. (See Fig 3.11 of your textbook). A) At physiological pH (= 7.4), what is the net charge on the tripeptide Asp-Arg-Glu-His? B) Calculate the pI of this tetrapeptide. [Hint: Using the pK, values in Table 2.1 and the Henderson-Hasselbalch equation, determine the pH when the...
Exercise IV. Fill in the Blank 1. The method of Centrifugation, polyacrylamide gel electrophoresis, western blotting, affinity purification) is the most widely used technique for determining the approximate molecular weight of a protein. 2. (Centrifugation, affinity chromatography, sonication, gel electrophoresis) is a method in which macromolecules are separated due to their size, charge, and other physical properties 3. SDS-PAGE is a form of electrophoresis in the presences of a/an (acidic solution, basic solution, anionic detergent, cationic detergent). 4. SDS not...
1. Figure I shows an SDS-PAGE gel. A) Rank the 3 proteins by size, from largest to smallest. Explain why this trend is observed in SDS-PAGE gels. B) What is the purpose of SDS in SDS-PAGE? C) Sample L is the ladder. What is its purpose? D) Typically, PA (polyacrylamide) is used as the gel for protein electrophoresis, whereas agarose is used for DNA electrophoresis. Explain why a different gel material is used, Specifically referring to the pore size of...
parts a,b, c please
3. Sodium dodecyl sulfate (SDS) polyacrylamide gel electrophoresis a. After pouring the SDS polyacrylamide gel, you realize that instead of 2 ml, you used 4 ml of 30% acrylamide/bisacrylamide solution for the preparation of the separating gel (in both cases for 5 ml, total gel volume). How would this affect the separation of your proteins during SDS PAGE? Explain your answer! b. You have to remake the gel and are now making sure just to add...
The PCR procedure can be performed with fluorescently labeled
primers and polyacrylamide gel electrophoresis (PAGE). What would
be the advantage of this procedure over agarose gel analysis?
PAGE allows for higher resolution than the agarose gel
procedure.
The PAGE procedure is faster than that using agarose gel
electrophoresis.
The labeled primers are less expensive because they are used at
a lower concentration in the reaction mix.
The PAGE procedure is less prone to contamination
Case Study 12-2 A 7-month-old child...
32. Which of the following would make a protein of a large size move faster through an SDS gel electrophoresis separation? a. add more protein to your sample b. add more buffer c. remove some buffer d. decrease the acrylamide concentration of the gel e. increase the acrylamide concentration of the gel 33. Which of the following statements are accurate? i. SDS binds to proteins, introducing a negative charge which is proportional to the length of the protein primary structure....
The picture above represents an agarose gel that was used to analyze plasmid DNA after it was cut with the restriction enzyme HindIll. The plasmid was incubated with Hindill until all of the available Hindlll cut sites were cut by HindIll. After running the sample on the gel, three bands were detected (Note that there are three wells shown at the top of the gel for loading samples, however, only the middle well was loaded with sample). Based on this...
Biologists use gel electrophoresis to sort DNA segments by size. DNA segments are placed at one end of a gel. DNA is negatively charged (with a charge of two electrons per base pair). When you “run the gel” you are generating an electric field by connecting anodes and cathodes at the ends of the gel. This causes the negatively charged DNA segments to move towards the positive electrode. After running the gel, smaller DNA segments have moved farther from the...
One strand of a DNA sequences is given below. Find the
EcoRI sites and indicate the cutting site with an arrow. Count the
number of bases in each fragment.
CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...
18 15 16 17 7- What is the concentration of DNA whereby a 1:100 dilution has an observance reading of 0.015 at 260 nm? a. 6 ug mL b. 60 ug/mL c. 75 ug/mL d. 750 ug/mL 8- When measuring the concentration of RNA by spectrophotometry at 260 nm, the absorbance reading is multiplied by the dilution and a conversion factor of a. 20 6.30 c. 40 d. 50 9-DNA is isolated from a clinical sample. The absorbance at 260...