Question

A point mutation at which of the 3 bases in the threonine is least likely to...

A point mutation at which of the 3 bases in the threonine is least likely to have a deleterious effect? (ACU), (ACG), (ACA), (ACC)

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Third base

This is because if, say, mutation occurs in ACU and it gets converted to ACG, or to ACA, or to ACC, then even after mutation threonine will be formed.

But if mutation occurs in first or second base then the amino acid will change.

If ACU gets converted to CCU, then proline will be formed or if to GCU, then alanine will be formed.

If mutation occurs at first or second nucleotide, the amino acid will change which will result in the change in bonding pattern of the protein. This will cause but change in structure of the protein which will ultimately change its function.

Please rate.

Add a comment
Know the answer?
Add Answer to:
A point mutation at which of the 3 bases in the threonine is least likely to...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is...

    Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is in, what effect it will have on the protein (e.g. nonsense missense, silent) as well as the amino acid change it will cause if it is a substitution. Refer to the genetic code. U UUU C UCU Uục Phe UCC Ser UUA UUG CUU UCA UCG CCU CCC Α UAU UAC y UGC cys UAA Stop UGA Stop UAG Stop UGG trp CGU CAC"...

  • A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....

    A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...

  • Question 11 (1 point) Which type of mutation is the least likely to occur? a) Gain...

    Question 11 (1 point) Which type of mutation is the least likely to occur? a) Gain of function mutation b) Lethal mutation. O ) Loss of function mutation. d) Neutral mutation. Question 12 (1 point) Which type of mutation is least likely to be passed on to future generations of cells? a) Gain of function mutation. b) Lethal mutation. Oc) Loss of function mutation. d) Neutral mutation. Question 13 (1 point) Which type of mutation tends to accumulate at a...

  • Gene Mutation Worksheet 1. There are several types of gene mutations. (a) List two. (b) What...

    Gene Mutation Worksheet 1. There are several types of gene mutations. (a) List two. (b) What do they have in common? (c) How are they different? 2. A geneticist found that a particular DNA mutation had no effect on the protein coded by a gene. What kind of mutation was this? Why? 3. (a) Name one amino acid that has more than one codon. (b) Name an amino acid that has only one codon 4. Look at the following sequence:...

  • Which mutation is most likely to have a severe impact on the phenotype of an organism...

    Which mutation is most likely to have a severe impact on the phenotype of an organism if it occurs within the first several bases of a gene coding region? A) a frameshift mutation of three nucleotides B) a missense mutation affecting one nucleotide C) a missense mutation affecting three nucleotides D) a silent mutation affecting one nucleotide E) a frameshift mutation of one nucleotide

  • 41) One codon for threonine i 5. ACU 3. The URNA molecule which threonine molecule will...

    41) One codon for threonine i 5. ACU 3. The URNA molecule which threonine molecule will have which sequence in its anticodon e ERNA molecule which furnishes the we a) 3' UGT 5' b) 3' UCA 5. c) 3' ACU 5. d) 3' UGA 5' e) 3' TGA 5 During the replication of DNA, the DNA base sequence S'AGCAT" original strand will generate which of the following sequences on strand? a) 5' ATCAG 3. b) 5 AGCAT 3. c) 5'...

  • Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence...

    Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence got changed to ACA (original = ACG) 4. codon #2 got changed to ACC 5. codon #2 got changed to ACT o Explain the consequences of each mutation in #3-5 (how would it change the outcome?) o Use this sequence of nucleotides (DNA): 3'TACACGGCCCTTGGAAAACACACT5 1. Transcribe the DNA 2. Translate the DNA using genetic code dictionary

  • Which of the following is the LEAST likely direct consequence of a substitution mutation? creating a...

    Which of the following is the LEAST likely direct consequence of a substitution mutation? creating a non-functional version of a protein creating a new version of a protein creating a new amino acid in the universal genetic code creating a different codon in a gene creating a new allele of a gene

  • A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3'...

    A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...

  • The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the...

    The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the transcriptional start site, as discussed during the class. (a) What is the sequence of the RNA that is transcribed? Write the sequence as 5' to 3: 5'CAGTACTATCCAAGACATGGCGACA 3' 3' GTCATGATAGGTTATGTACCGCTGT 5' -3. The RNA sequence is: 5'- (b) Write the peptide sequence that will be translated (if any) when this gene gets transcriptionally active. Use the genetic code provided below, and write the sequence...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT