Question

Treatment with the chemical Bls18 causes a nucleotide to be changed from a C to a...

Treatment with the chemical Bls18 causes a nucleotide to be changed from a C to a G within the

translated region of the MseOS gene. You find that in your treated cells, the protein is the same size, but

has a different conformation/shape? Briefly explain how you knew that. (2-3 sentences)

0 0
Add a comment Improve this question Transcribed image text
Answer #1

if you like the answer please press like .

Add a comment
Know the answer?
Add Answer to:
Treatment with the chemical Bls18 causes a nucleotide to be changed from a C to a...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Treatment with the chemical Bls18 causes a nucleotide to be changed from a C to a G within the tr...

    Treatment with the chemical Bls18 causes a nucleotide to be changed from a C to a G within the translated region of the MseOS gene. You find that in your treated cells, the protein is the same size, but has a different conformation/shape? Briefly explain how you knew that.

  • Background info: Leishmania is a parasite that causes a disfiguring infection that is treated by antimony....

    Background info: Leishmania is a parasite that causes a disfiguring infection that is treated by antimony. Antimony works because the parasites have a transporter protein that imports the chemical into parasite cells. Doctors found that many infections had become resistant to antimony, the standard treatment for this infection.When they sequenced the genomes of Leishmania from treatment-resistant Leishmania, scientists found that the gene encoding the protein transporter contained two inserted nucleotides. Question: How would you explain to non-scientist patients how the...

  • Shown below is the anti-sense DNA sequence from a region of a gene that produces a...

    Shown below is the anti-sense DNA sequence from a region of a gene that produces a specific protein. Mutations in this region of the gene cause a disease CTT TTA TAG TAG ATA CCA CAA AGG a. What is the mRNA strand that is transcribed from the DNA shown above? b. What is the amino acid sequence that would be translated from the mRNA strand you determined in part 1? c. If an individual has a G at position 15...

  • Background info: Leishmania is a parasite that causes a disfiguring infection that is treated by antimony....

    Background info: Leishmania is a parasite that causes a disfiguring infection that is treated by antimony. Antimony works because the parasites have a transporter protein that imports the chemical into parasite cells. Doctors found that many infections had become resistant to antimony, the standard treatment for this infection.When they sequenced the genomes of Leishmania from treatment-resistant Leishmania, scientists found that the gene encoding the protein transporter contained two inserted nucleotides. Question: One patient asks whether the same effect could have...

  • Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript...

    Question 2: Transcription, RNA Processing and Translation A particular gene codes for a mature mRNA transcript containing 1200 bases, which is translated into a protein containing 300 amino acids. A. How long is the coding sequence in this mRNA and how many nucleotides are in the UTRs? For the purposes of this question we are ignoring the G’ cap and the polyA tail. B. A mutant form of the gene created by one nucleotide being changed to another nucleotide also...

  • A. What is a nucleotide? What are the subunits of nucleotide? B. What is a nitrogen...

    A. What is a nucleotide? What are the subunits of nucleotide? B. What is a nitrogen base? Name the four nitrogen bases in DNA (A, C, G, T….remember the full names). C. Explain the structure of DNA, why is it referred as Watson and Crick model? Given a sequence of DNA, you should be able to find its complementary nitrogen bases.For example the complementary nitrogen bases for AGTCGC sequence is D. What is RNA? How many kinds of RNA, (mRNA,...

  • molecular biology Section C (40 marks) Answer ALL questions from this Section 5. You have isolated total RNA from muscle cells and constructeda muscle cDNA library. You wish to study the regulatory r...

    molecular biology Section C (40 marks) Answer ALL questions from this Section 5. You have isolated total RNA from muscle cells and constructeda muscle cDNA library. You wish to study the regulatory region of a muscle-specific cDNA gene (gene M) that you have previously identified. 6 (a) For your study, you need to isolate a genomic clone of gene M. Why isa cDNA clone of gene M not appropriate for your study? (2 marks) (b) Outline the steps you would...

  • 2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the...

    2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...

  • You want to make E. coli bacteria that glow green. Your plan is to insert the...

    You want to make E. coli bacteria that glow green. Your plan is to insert the gene for green fluorescent protein (GFP) from a jellyfish (a eukaryote) into the genome of the bacteria so that the mRNA is transcribed by the E. coli cells and translated into protein. What changes do you need to make to the jellyfish GFP gene sequence to make sure that the bacteria will make a functional protein? Why? (1 point) A type of amatoxin binds...

  • An antibody is very specific for an epitope, such as a region of a protein. A...

    An antibody is very specific for an epitope, such as a region of a protein. A researcher performs a Western blot using an antibody that is specific to her unique protein of interest and sees three distinct band sizes on her blot - one at the expected size, one slightly larger than the expected size, and the other slightly smaller than the expected size. She confirms that for her samples, the gene encoding this protein is in the homozygous wild-type...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT