A. What is a nucleotide? What are the subunits of nucleotide?
B. What is a nitrogen base? Name the four nitrogen bases in DNA (A, C, G, T….remember the full names).
C. Explain the structure of DNA, why is it referred as Watson and Crick model? Given a sequence of DNA, you should be able to find its complementary nitrogen bases.For example the complementary nitrogen bases for AGTCGC sequence is
D. What is RNA? How many kinds of RNA, (mRNA, tRNA and rRNA), know the function of each one of them. Which one of these three RNA gets translated into protein?
C. What are the nitrogen bases in RNA (as opposed to DNA)? Remember T is replaced by U in RNA. Compare and contrast DNA and RNA (you will find a comparison table in your text book or the power point). You have to remember T in RNA is replaced by U.
A. What is a nucleotide? What are the subunits of nucleotide? B. What is a nitrogen...
the several other 10.4 to show t 3. The base uracil substitutes for the base thymine in RNA. Complete Table ways RNA differs from DNA Table 10.4 DNA Structure Compared with RNA Structure RNA Sugar Bases Strands Helix DNA Deoxyribose Adenine, guanine, thymine, cytosine Double stranded with base pairing Yes Complementary Base Pairing Complementary base pairing occurs between DNA and RNA. The RNA base uracil pairs with the DNA base adenine; the other bases pair as shown previously. Complete Table...
choose the right answer : 1- what is degradation of ' unwanted' proteins in eukaryotic cells A- polyribosomes B- proteasomes C- editosome D- spliceosomes 2- addition or deletion of bases causes which kind of mutation A- transition B- transcription C- transversion D- frameshift mutation 3- point mutation involve : A- change in single base pair B- deletion C- duplication D- insertion 4- what is the complementary m-RNA sequence for the DNA sequence C-A-A-G-G-T A- C-A-A-G-G-U B- G-U-U-C-C-A C- C-A-A-G-G-T D-...
In the diagram below, you are provided with a known sequence of
DNA (DNA Strand 1). Write ALL your answers as a sequence of CAPITAL
LETTERS (e.g., GGCGGT), and work your way from the top to the
bottom.
A) Fill in the complementary DNA bases for DNA Strand 2 to form a
complete double-stranded DNA molecule.
B) Create an mRNA strand that is complementary to DNA Strand
1.
C) Using the mRNA sequence that you just created, determine the
complementary...
s141) Which nucleotide is used for energy to drive protein synthesis? A) TTP B) CTP C) UTP D) GTP 2) Ribosomal RNA: A) Can bind to prokaryotic mRNA B) Plays no role in peptidyl transferase activity C) In eukaryotes, attaches to mRNA before transcription is completed D) All of the above 3) Spliceosomes: A) Are 40-60S, about the size of ribosomal subutnit B) Are necesssary for DNA replication C) Bind to RNA Polymerase D) Are composed entirely of proteins E)...
EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise 8 to make the protein for which it codes. STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGGCAGAACC STEP 2 Draw the DNA strand separating down the middle (as in the beginning of DNA replication). STEP 3 Draw the free-floating RNA bases linking up with the top...
1.) An RNA molecule has the following percentrages of bases A = 27% , U=38% , C=20% , G= 15% a. Is this RNA molecules single stranded or double stranded? How Cant you tell? b. What would be the percentage of each of the bases in the template strand of the DNA that contains the genes for this RNA? 2.) Given the following DNA 5' ATG GCG AGG CGG CAGCTGTTATGGTGA - 3' a. What is the transcript (mRNA) sequence? b....
2. When transcribing an mRNA strand, RNA polymerase uses the strand of DNA to match complementary bases with. RNA polymerase always reads this strand in the direction and always builds mRNA in the direction. (1.5 pts) 3. (0.5 pt) What is the significance of the +1 site in regards to transcription of mRNA? t) When translating an mRNA sequence, where does the ribosome always begin? 5. (0.5 pt) When translating an mRNA sequence, what signals the ribosome to end translation?...
What are the three functional groups that comprise a nucleotide? What do nucleotides have in common with amino acids or simple sugars? When the structure of DNA was first elucidated, many biologists quickly saw how this structure explained the passage of information from one generation to another. How does the structure of DNA explain generation-to-generation flow of information? In other words, give a brief description of the structure of DNA and tell how this structure allows for replication. Which of...
DNA exercises Ex. 1 Use the genetic code chart (Fig. 10.8A or the one in your LN) to translate the following mRNA sequences into amino acid sequences and answer the questions. mRNA nucleotide sequence (mRNA1) AUGGCAGACAAUAUUAAGUGA 1. What is the amino acid sequence? Mutation in the mRNA nucleotide sequence (mRNA2) AUGGCAGACCAUAUUAAGUGA 2. What is the new amino acid sequence? 3. How many bases were changed in mRNA2 compared to mRNA1? 4. What type of mutation was this? 5. How many...
Complete the following table and answer the next two questions (3.5 marts) 10 B I = U Ꭶ X2 x E I 19 эс ✓ C Finis DNA strand G C А DNA strand TAC TAC mRNA codon AUG C G G tRNA anticodon G - Amino acid Tryptophan Stop mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides corresponds to an amino acid in the protein that gets built...