In TRANSCRIPTION, which molecule is a template and which is forming the newly constructed polymer?
Here are the choices:
Template
New polymer
Neither template nor monomer
Genome sequence
Insert choices to each of the following:
tRNA
mRNA
Promoter
rRNA
amino acid
Template
New polymer
Neither template nor monomer
Genome sequence
tRNA
mRNA
Promoter
rRNA
amino acid
In TRANSCRIPTION, which molecule is a template and which is forming the newly constructed polymer? Here...
Which of the following is the template for transcription? The molecule that carries codons The molecule that carries anticodons The molecule that carries base triplets The molecule that carries amino acids The molecule that carries tRNA Cytokinesis begins with the formation of an indentation around the cell called the asters. centromere. cleavage furrow. equator.
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
Question 3 (4 pts): The following table provides just enough information about a section of a particular gene to allow you to determine: (a) the sequence of the base pairs along the DNA, (b) which DNA strand serves as the template for mRNA transcription, (c) the mRNA nucleotide sequence, (d) the tRNA anticodons, and (c) the amino acid sequence of the polypeptide. Complete the table and make sure you indicate which DNA strand is the template for mRNA transcription and...
Please explain
Why is a cap added to MRNA, but not to 1RNA or RRNA? Each of the three types of RNA are transcribed by different RNA polymerases. Only RNA polymerase II, involved in mRNA synthesis, contains a domain capable of interacting with enzymes that form the cap. Transcription and processing of MRNA occur in the nucleus, where cap binding proteins are found. These proteins, which add and modify the cap, are not found in the cytoplasm, where tRNA and...
The following questions pertain to DNA replication, transcription, and translation. Below is part of a DNA sequence: TACCAAGGAGCATTAGATACT a.) What is the complementary DNA sequence that would be made if the sequence shown above were used as the template strand during DNA replication? (1 pt) b.) What is the mRNA that would be made from the DNA sequence shown (the sequence given NOT your answer to part a) if it were used as the template strand during transcription? (1 pt)...
If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...
Polymerization of amino acids into a polypeptide requires energy. In terms of chemical thermodynamics, the chemical energy for peptide bond formation in translation technically comes from: hydrolysis of GTP hydrolysis of ATP translocation of the ribosome as it moves along the mRNA ribosomal RNA (rRNA) secondary structure transcription of the mRNA that is being translated Transfer RNA (tRNA) is a ribonucleic acid about 50-60 nucleotides long. When a tRNA gets "charged" by covalent addition of its cognate amino acid, to...
6. A double-stranded DNA molecule with the sequence shown here produces a polypeptide that is 5 amino acids long. The sequence does not include the promoter. Transcription is proceeding left to right(). thlt TEAM 3' ATGradGGCTAAAGTGCCATCTAAAGATCGTACAT 5' loding 5' TACATGCCGATTTCACGCTAGATTTCTAGCATGTA 3' shar a. Label the template and coding strands. b. In the template strand, underline the nucleotides that will encode the start codon. c. The stop codon for the polypeptide is (UAA (UAG UGA).(circle the correct answer) d. In the...
1. Which of the following statements concerning transcription of bacterial mRNA is not true? Bacterial mRNA must have intron material removed before it can be used in the process of protein translation.* Energy necessary for transcription is provided by the breaking of phosphate bonds carried by ribonucleotide triphosphates (rNTPs). A sigma factor recognizes the promoter site sequences on the DNA strand during transcription. A guanine-rich sequence on the template DNA molecule causes the growing RNA strand to loop and detach.
answer all the questions
18) A mutation occurs such that a spliceosome cannot remove one of the introns in a gene. What effect will this have on the gene? Translation will continue, but a nonfunctional protein will be made b) Translation will continue and will skip the intron sequence c) It will have no effect; the gene will be transcribed and translated into protein d) Transcription will terminate easily and the protein will not be made 19. During the process...