Which of the following is the template for transcription?
The molecule that carries codons
The molecule that carries anticodons
The molecule that carries base triplets
The molecule that carries amino acids
The molecule that carries tRNA
Cytokinesis begins with the formation of an indentation around the cell called the
|
asters. |
||
|
centromere. |
||
|
cleavage furrow. |
||
|
equator. |
which of the following is the template for transcription
Answer: The molecules that carries tRNA
Rational: The DNA has to changed to RNA for further growth, so that the DNA will get copied and formed as the RNA. For to achieve this process, this has to undergone some process like transcription and translation.
tRNA is otherwise called as Transfer RNA. It has the amino acid which will used in the template for transcription.
Cytokinesis begins with the formation of an indentation
around the cell called the
Answer: cleavage furrow.
Which of the following is the template for transcription? The molecule that carries codons The molecule...
Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...
In TRANSCRIPTION, which molecule is a template and which is forming the newly constructed polymer? Here are the choices: Template New polymer Neither template nor monomer Genome sequence Insert choices to each of the following: tRNA mRNA Promoter rRNA amino acid Template New polymer Neither template nor monomer Genome sequence tRNA mRNA Promoter rRNA amino acid
4. Use the following terms to fill in the blanks below. cleavage furrow centromere equator mitotic spindle cytokinesis sister chromatids c hromosomes During metaphase, chromosomes line up along the of the cell. The two are held together with a refers to the division of the cytoplasm into two daughter cells. Genetic information in cells is contained in structures called • During anaphase, part of the can be seen attached to the centromere of each sister chromatid. The constricted appearance of...
Which of the following is not an essential function of ribosomes in all domains of life? A. Catalyze peptide bond formation between amino acids during polypeptide formation. B. Bind messenger RNA and identify the start codon where translation begins. C. Facilitate the complementary base pairing of mRNA codons and tRNA anticodons that determines amino acid order in the polypeptide. D. Align the Shine Delgarno sequence in the mRNA with a complementary sequence in the 16S rRNA of the small ribosomal...
Question 3 (4 pts): The following table provides just enough information about a section of a particular gene to allow you to determine: (a) the sequence of the base pairs along the DNA, (b) which DNA strand serves as the template for mRNA transcription, (c) the mRNA nucleotide sequence, (d) the tRNA anticodons, and (c) the amino acid sequence of the polypeptide. Complete the table and make sure you indicate which DNA strand is the template for mRNA transcription and...
If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...
10. With regard to transcription, the enzyme begins of a DNA transcribing RNA after it attaches to the molecule. With regard to translation, the begins translating a polypeptide after it attaches to the __ of an mRNA molecule. Start and stop codons are involved in the process of The start codon is , while the stop codons are 11. and Does the start codon specify an amino acid? If so, which one(s)? Do the stop codons specify an amino acid?...
c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose 15. Use Figure 2 and 3 of the lab to compare the genome of a human with a mouse, fruit fly and yeast. paired in a specific way. d) Adenine in one DNA strand always pain with thymine ) Bases in opposite strands of a DNA molecule are linked together by hydrogen in the other strand and bonds. Yeast Human Mouse Fruit Fly Number...
1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...
The following sequence represents triplets on DNA TAC CAG ATA CAC TCC CCT GCG ACT A. Give the mRNA codons and tRNA anticodons that correspond with this sequence. B. Using the above piece of DNA, show a deletion, insertion, a substitution, and nonsense mutation. Which ones are frame-shift mutations? Are any of your mutations missense? Use the table of codons and amino acids in the textbook to answer this part of the question. For microbiology