Question

Retroviruses use the enzyme reverse transcriptase to Retroviruses use the enzyme reverse transcriptase to synthesize a...

Retroviruses use the enzyme reverse transcriptase to

Retroviruses use the enzyme reverse transcriptase to

synthesize a hybrid molecule with one DNA stranded base-paired to the complementary RNA strand.
synthesize double-stranded RNA.
direct the production of DNA from a single-stranded RNA genome.
transcribe mRNA from a DNA genome.
synthesize sense-stranded mRNA from an antisense RNA genome.
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Direct production of dna from single stranded rna genome

note - the enzyme reverse transcriptase help in formation of dna from rna . The enzyme is involved in bacterias having rna genome and for the function of the bacteria cell the dna is needed which is reverse transcribe by the enzyme .

Add a comment
Know the answer?
Add Answer to:
Retroviruses use the enzyme reverse transcriptase to Retroviruses use the enzyme reverse transcriptase to synthesize a...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Question 10 0.5 pts Order the steps in RT-PCR: • Add one primer complementary to the...

    Question 10 0.5 pts Order the steps in RT-PCR: • Add one primer complementary to the 3' end of the RNA of interest. Also add the RT enzyme (reverse transcriptase), dNTPs, and a buffer with Mg2+ Incubate the reaction appropriately. • Degrade the RNA strand with base, leaving just the cDNA. • cDNA is produced, which is single-stranded and complementary to the RNA of interest. • Double-stranded DNA for the region of interest is produced. • Add two primers (one...

  • 1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2....

    1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...

  • ........have genomes that consist of (+) strand RNA. Instead of RNA polymerase, they package a reverse...

    ........have genomes that consist of (+) strand RNA. Instead of RNA polymerase, they package a reverse transcriptase, which transcribes the RNA into a double-stranded DNA. The double-stranded DNA is then integrated into the host genome, where it directs the expression of the viral genes.

  • 1.) What is the reaction catalyzed by the enzyme reverse transcriptase? a.  Synthesis of RNA from a...

    1.) What is the reaction catalyzed by the enzyme reverse transcriptase? a.  Synthesis of RNA from a DNA template b. Synthesis of DNA from a single-stranded RNA molecule c. Cleavage of DNA at a sequence-specific site d. Circularization of restriction fragments e. Ligation of DNA fragments 2.) In Bacillus subtilis, regulation of transcription of the trp operon is A. Controlled solely through attenuation B. Mediated by a protein denoted TRAP C. Independent on translation D. All of the above E. B...

  • All EXCEPT which of the following are characteristics of retroviruses? All EXCEPT which of the following...

    All EXCEPT which of the following are characteristics of retroviruses? All EXCEPT which of the following are characteristics of retroviruses? cause lysis of the host cell upon infection integration of the viral genome into the host genome genome composed of RNA synthesis of DNA from an RNA template by reverse transcriptase, a virally-encoded enzyme

  • “Unlike what happens in DNA replication, where both strands are copied, only one of the two...

    “Unlike what happens in DNA replication, where both strands are copied, only one of the two strands is transcribed into mRNA. The DNA strand that contains the gene is sometimes called the sense strand, or coding strand, and the DNA strand that gets transcribed to give RNA is called the antisense strand, or noncoding strand. Because the sense strand and the antisense strand are complementary, and because the DNA antisense strand and the newly formed RNA strand are also complementary,...

  • Order the steps in RT-PCR: 1. Add one primer complementary to the 3' end of the...

    Order the steps in RT-PCR: 1. Add one primer complementary to the 3' end of the RNA of interest. Also add the RT enzyme (reverse transcriptase), dNTPs, and a buffer with Mg2+. Incubate the reaction appropriately. 2. Degrade the RNA strand with base, leaving just the cDNA. 3. cDNA is produced, which is single-stranded and complementary to the RNA of interest. 4. Double-stranded DNA for the region of interest is produced. 5. Add two primers (one forward and one reverse)...

  • Match the term with its correct definition. 1.retrovirus 2. reverse transcription 3. reverse transcriptase 4.Virus   ...

    Match the term with its correct definition. 1.retrovirus 2. reverse transcription 3. reverse transcriptase 4.Virus       Small particles that cannot replicate without a host cell A polymerase enzyme that uses RNA to synthesize complementary DNA strands The virus that contains RNA as its genetic material The process where a virus makes its viral DNA.

  • HIV's genome of RNA includes the code for reverse transcriptase (RT), an enzyme that acts early...

    HIV's genome of RNA includes the code for reverse transcriptase (RT), an enzyme that acts early in infection to synthesize a DNA genome off of an RNA template. The HIV genome also codes for protease (PR), an enzyme that acts later in infection by cutting long viral polyproteins into smaller, functional proteins. Both RT and PR represent potential targets for antiretroviral drugs. Drugs called nucleoside analogs (NA) act against RT, whereas drugs called protease inhibitors (PI) act against PR. Which...

  • What does the enzyme reverse transcriptase do? A) Using the amino acid sequence of a protein...

    What does the enzyme reverse transcriptase do? A) Using the amino acid sequence of a protein as a template, it makes an RNA molecule. B) Using RNA as a template, it makes a DNA molecule. C) Using RNA as a template, it makes an RNA molecule. D) Using DNA as a template, it makes an RNA molecule. E) Using DNA as a template, it makes a DNA molecule.

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT