Which types of mutations in DNA can lead to the translation of a non-functional protein product?...
Which types of mutations in DNA can lead to the translation of a non-functional protein product?
- Missense
- Nonsense
- Antisense
- Silent
- Frameshift
P.S. can be up to 3 options correct if applicable
Homework Answers
Answer - Missense, Nonsense, Frameshift
Missense mutation the single amino acid change to some other amino acid leads to non functional protein.
Nonsense mutation the stop codon is form due to mutation leads to truncated protein.
Frameshift mutation due to deletion and insertion total codon undergo frameshift leads to different protein.
Add Answer to:
Which types of mutations in DNA can lead to the translation of a
non-functional protein product?...
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino aci...
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino acids: TACCATTCGGGTCTCCTTGATCTGGCTATC "mutated" DNA: TACCATTCGGCGTCTCCTTGATCTG GCTAT C mRNA Amino acids What type of mutation is this (circle the correct answer)? Substitution/point mutation or frameshift mutation If a substitution/point mutation, what kind of substitution or point mutation is it (circle the correct answer)? Silent, missense, or nonsense Page 4 of 4
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino...
1. Using the following DNA segment, the RNA transcribed and the translation DNA 5’ ATG CCG...
1. Using the following DNA segment, the RNA transcribed and the translation DNA 5’ ATG CCG GGT ACA TTC GGC CCA TAC 3’ DNA 3’ TAC GGC CCA TGT AAG CCG GGT ATG 5’ RNA 5’ AUG CCG GGU ACA UUC GGC CCA UAC 3’ Protein met pro gly thr phe gly pro. tyr DRAW an example of each of the following (circle the mutation that has occurred): A silent mutation A frameshift mutation A nonsense mutation A missense mutation
Which of the following statements regarding gene mutations is NOT true? Conditional mutations have different phenotypic...
Which of the following statements regarding gene mutations is NOT true? Conditional mutations have different phenotypic effects under different conditions and can be used to study the function of essential genes. Silent mutations cannot have any phenotypic effect on an organism. Frameshift mutations often result in a truncated protein product, similar to a nonsense mutation. Dominant mutations have a phenotypic effect despite the presence of one functional wild type allele.
A ________ mutation results in no change in the protein product. mutation results in no change...
A ________ mutation results in no change in the protein
product.
mutation results in no change in the protein product O O O A silent B. nonsense C. missense D. non functional .
3. In E. coli translation of genes that contain a frameshift mutation often result in a...
3. In E. coli translation of genes that contain a frameshift mutation often result in a truncated protein. This is because the frameshift mutation often result in a nonsense codon downstream in the DNA sequence. Can you come up with a reason why nonsense mutations are so prevalent after a shift in reading frame in an E. coli DNA sequence? (1 marks)
In E. coli translation of genes that contain a frameshift mutation often result in a truncated...
In E. coli translation of genes that contain a frameshift mutation often result in a truncated protein. This is because the frameshift mutation often result in a nonsense codon downstream in the DNA sequence. Can you come up with a reason why nonsense mutations are so prevalent after a shift in reading frame in an E. coli DNA sequence?
1. You have used a mutagen to induce mutations in a DNA sequence. If the original DNA...
1. You have used a mutagen to induce mutations in a DNA sequence. If the original DNA strand is 5'-ATGGGACTAGATACC-3', then which of the following represents a nonsense mutation? (1pt) 5'-ATGGGTCTAGATACC-3' 5'-ATGCGACTAGATACC-3' 5'-ATGTGACTAGATACC-3' 5'-ATGGGACTAAGATACC-3' 2. A mutation that changes a codon sequence, and subsequently changes the amino acid that should have been placed at that point in the polypeptide chain, is called a… (1pt) silent mutation frameshift mutation missense mutation nonsense mutation 3. Excision repair corrects DNA by (1pt) correcting A=T...
Which of the following mutations could result in a truncated protein? Choose all that apply. A...
Which of the following mutations could result in a truncated protein? Choose all that apply. A missense mutation that changes a phenylalanine to a leucine O A two base pair frameshift O An in-frame removal of three base pairs O A one base pair frameshift A chromosomal-level deletion O o A chromosomal-level insertion O A nonsense mutation that changes a cysteine to a stop codon
Which of the following mutations is most likely to result in a non-functional protein? a) a...
Which of the following mutations is most likely to result in a non-functional protein? a) a single-nucleotide substitution in a promoter b) an insertion in an intron c) a frameshift mutation d) a missense mutation You have conducted an Ames test on a given compound to determine whether it is a mutagen. Which of the following would be classified as a positive result on the Ames test? a) originally His+ strain grows on minimal medium with histidine. b) originally His+...
*Hint: You will have one of each type. Types of Mutations? Point - Missense Frameshift -...
*Hint: You will have one of each type. Types of Mutations? Point - Missense Frameshift - Insertion Point - Nonsense Frameshift Deletion Point - Silent Original DNA Sequence: TACACCTTGGCGACT mRNA Sequence: AUG Amino Acid Sequence: Mutated DNA Sequence #1: TACATCTTGGCGACT What's the mRNA sequence? (Circle the change) AUG TALAALLA What will be the amino acid sequence? Will there likely be effects?_ What kind of mutation is this? Mutated DNA Sequence 12: TACGAC CTTGGCGACT What's the mRNA sequence? (Circle the change)...
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino acids: TACCATTCGGGTCTCCTTGATCTGGCTATC "mutated" DNA: TACCATTCGGCGTCTCCTTGATCTG GCTAT C mRNA Amino acids What type of mutation is this (circle the correct answer)? Substitution/point mutation or frameshift mutation If a substitution/point mutation, what kind of substitution or point mutation is it (circle the correct answer)? Silent, missense, or nonsense Page 4 of 4
Chapter 7 Section 7.7: Mutations and Their Effects Name: Problem 3: "normal" DNA: mRNA: Amino...
A ________ mutation results in no change in the protein
product.
mutation results in no change in the protein product O O O A silent B. nonsense C. missense D. non functional .
3. In E. coli translation of genes that contain a frameshift mutation often result in a truncated protein. This is because the frameshift mutation often result in a nonsense codon downstream in the DNA sequence. Can you come up with a reason why nonsense mutations are so prevalent after a shift in reading frame in an E. coli DNA sequence? (1 marks)
Which of the following mutations could result in a truncated protein? Choose all that apply. A missense mutation that changes a phenylalanine to a leucine O A two base pair frameshift O An in-frame removal of three base pairs O A one base pair frameshift A chromosomal-level deletion O o A chromosomal-level insertion O A nonsense mutation that changes a cysteine to a stop codon
*Hint: You will have one of each type. Types of Mutations? Point - Missense Frameshift - Insertion Point - Nonsense Frameshift Deletion Point - Silent Original DNA Sequence: TACACCTTGGCGACT mRNA Sequence: AUG Amino Acid Sequence: Mutated DNA Sequence #1: TACATCTTGGCGACT What's the mRNA sequence? (Circle the change) AUG TALAALLA What will be the amino acid sequence? Will there likely be effects?_ What kind of mutation is this? Mutated DNA Sequence 12: TACGAC CTTGGCGACT What's the mRNA sequence? (Circle the change)...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago