Write a detailed guideline on how to analyze a random DNA sequence in FASTA format.
FASTA format is basically based on text used in the field of bioinformatics and biotechnology, it represents the amino acid sequence and by single letter code.
Here the DNA Sequences are expected to be represented in the standard IUB/IUPAC amino acid and nucleic acid codes:
DNA sequencing is the determination of neucleotides in the order of the four bases Adenine (A), Guanine (G), Cytosine (C) and Thymine (T), in a strand of DNA.
Step 1: Denaturation
Step 2: Attachment of primers and extension of bases
Step 3: Termination
Step 4: Polyacrylamide gel Electrophoresis


According to FASTA format: [1]
The nucleic acid codes are:
A --> adenosine M --> A C (amino)
C --> cytidine S --> G C (strong)
G --> guanine W --> A T (weak)
T --> thymidine B --> G T C
U --> uridine D --> G A T
R --> G A (purine) H --> A C T
Y --> T C (pyrimidine) V --> G C A
K --> G T (keto) N --> A G C T (any)
- gap of indeterminate length
The accepted amino acid codes are:
A ALA alanine P PRO proline
B ASX aspartate or asparagine Q GLN glutamine
C CYS cystine R ARG arginine
D ASP aspartate S SER serine
E GLU glutamate T THR threonine
F PHE phenylalanine U selenocysteine
G GLY glycine V VAL valine
H HIS histidine W TRP tryptophan
I ILE isoleucine Y TYR tyrosine
K LYS lysine Z GLX glutamate or glutamine
L LEU leucine X any
M MET methionine * translation stop
N ASN asparagine - gap of indeterminate length
( [1]Reference: The Yang Zhang Lab-University of Michigan )
Write a detailed guideline on how to analyze a random DNA sequence in FASTA format.
Write a Python program that converts an input file in FASTA format, called "fasta.txt", to an output file in PHYLIP format called "phylip.txt". For example, if the input file contains: >human ACCGTTATAC CGATCTCGCA >chimp ACGGTTATAC CGTACGATCG >monkey ACCTCTATAC CGATCGATCC >gorilla ATCTATATAC CGATCGATCG Then the output file should be human ACCGTTATACCGATCTCGCA chimp ACGGTTATACCGTACGATCG monkey ACCTCTATACCGATCGATCC gorilla ATCTATATACCGATCGATCG FASTA format has a description (indicated with a '>') followed by 1 or more lines of a DNA sequence. PHYLIP format has a description...
What is the gene sequence(FASTA format) and amino acid sequence for the CFTR gene/protein? If you can provide a link to where you find this, that would be amazing!
python/idle 1. Write a program that counts the number of A’s in a DNA sequence. The input is one sequence in FASTA format in a file called ‘dna.txt’. For example, if the file contains: >human ACCGT then the output of the program should be 1. Your program should work for any sequence and not just the one in the example.
Please develop a Java program to read in a piece of DNA sequence from a FASTA format sequence file (alternatively you can use the getRandomSeq(long) method of the RandomSeq class to generate a piece of DNA sequence), and then print out all the codons in three forward reading frames. Design a method called codon() that can be used to find all the codons from three reading frames. The method will take in an argument, the reading frame (1, 2, or...
Does your sequence match what is on the FASTA screen?
How similar are the data?
What does this mean with respect to alignment and similarity?
Explain fully
Sequence:
FVVKAVSDPG RQDIKGSAPL AVGLAIAAGH LCAIKLSGAS MNPARSFGPA
FASTA:
Using Perl Program: Write a program that will generate a DNA sequence (at random) of size 1000 bp. The sequence should contain all four nucleotides (A, G, C and T).
This assignment is worth four points. Create the sequence of a eukaryotic gene (DNA) that would: Be transcribed Encode a primary transcript that would be fully processed into mRNA, including having one intron spliced out Be translated into a protein with the amino acid sequence: MPLEASE. I suggest starting by writing out all of the sequence elements necessary for every step of transcription and translation, so that you make sure you include each of those elements in your gene. Report...
Write a PYTHON program that tests to see whether a sequence has an AT repeat. For this problem, we’ll define a repeat as 3 or more occurrences of AT, i.e. ATATAT…etc. Read in the sequence from a file (in FASTA format) to test your code. You can use the attached “Test.txt” sequence. Return a message to the user whether or not an AT repeat exits in the sequence. Use at least one function. Test.txt : >TestSeq ATGCTTTACGTCTACTGTCGTATGCTTTACGTCTACTGACTGTCGTATGCTTACGTCTACTGTCG TGCTTTACGTCTACTGACTGTCGTATATATATATATATATTGCTTTACGTCTACTGACTGTCGTA
The following DNA sequence encodes the beginning of the protein 5’ ATGCTAGCCCTAGCTGATAACATTCTACGTATAATAAATTTCCTA 3’ #1 Write the mRNA sequence of this stretch of DNA. (how it would read if this gene would be transcribed) #2 Write the protein sequence in single letter code that corresponds to the mRNA sequence.
20. Given the following DNA sequence, write the complementary RNA sequence then the amino acid sequence (hint: use the genetic code to translate from mRNA to protein!) DNA sequence: 3’- TACA A AGGUCTCCITAUGATC-5° mRNA: amino acid: