does IgA switch to IgG using DNA or mRNA

Question

Question

science biology

Answer 1

Answer #1

IgA switch to IgG is via using mRNA.It is in the step of mRNA processing that IgA is switched to IgG.

Answer 2

Similar Homework Help Questions

What are the relative percent concentrations of IgG, IgM, IgE, IgA, IgD in the body?

What are the relative percent concentrations of IgG, IgM, IgE, IgA, IgD in the body?
QUESTION 13 The only class of antibody that can cross the placenta is IgA. IgD. IgG....

QUESTION 13 The only class of antibody that can cross the placenta is IgA. IgD. IgG. IgE. QUESTION 14 Which of the following class of antibody is primarily found in external secretions? IgA IgD IgG IgE QUESTION 15 Epitopes or antigenic determinants are parts of the antibody molecule. are T cell receptors. are a portion of antigen recognized by antibody. may be approximately 10-25 amino acids in length. are a portion of antigen recognized by antibody AND may be approximately...
Does mRNA editing requires double strand DNA breakage?

Does mRNA editing requires double strand DNA breakage?

Complete the following paragraph to describe the different classes of antibodies. cytokines IgG IgA neutrophils immunoglobins...

Complete the following paragraph to describe the different classes of antibodies. cytokines IgG IgA neutrophils immunoglobins There are several classes of antibodies, or The main class found in blood is which is passed on to newborns through the mother's placenta The main class found in breast milk, saliva, tears, and mucus is The class of pentamer antibodies is IgM These are the first antibodies produced duringcel responses lgC Almost all antibodies of the class are bound to receptors on mast...
1.How does the genetic code in the DNA get passed on to the mRNA?

1.How does the genetic code in the DNA get passed on to the mRNA?
Recall that DNA is a template for mRNA. Every three mRNA nucleotides make up a codon...

Recall that DNA is a template for mRNA. Every three mRNA nucleotides make up a codon which corresponds to a specific amino acid. The properties of the amino acids determine how the protein folds. Explain how the differences in each of the DNA sequences used still allow each organism to make the same functional protein. (Note: A chart showing amino acids and the corresponding DNA genetic code may be useful. You can search for this online using the term “DNA...

Shown below is an mRNA sequence. Design a 15 nucleotide DNA probe to detect the mRNA...

Shown below is an mRNA sequence. Design a 15 nucleotide DNA probe to detect the mRNA using nucleic acid hybridization. 5' - AAUCGAUGGUCGAAAUGCTCGAUCAGCUAGCUAGC - 3'
Starting with this strand of DNA: 1) transcribe it into mRNA, 2) translate the mRNA into...

Starting with this strand of DNA: 1) transcribe it into mRNA, 2) translate the mRNA into its corresponding protein (USING SINGLE LETTER ABBREVIATIONS of the amino acids), and 3) determine the protein sequence if you had a DELETION mutation of the emboldened thymine. 3’ 5’ TCGGCGTGTACTACTACACGGTATATACGTTTCTTTTGATTAGCCGCTT
using the codon table, write mRNA and DNA (double stranded) sequence for the peptide below (assume...

using the codon table, write mRNA and DNA (double stranded) sequence for the peptide below (assume a stop codon is present and include it). Several correct sequences are possible due to the degeneracy of the genetic code; write only one sequence for each question. Remember to properly label ends. H2N - Methionine - Aspartate - Lysine - Serine - Valine - Leucine - COOH mRNA: DNA:

Translation uses ___ and ____ to synthesize ________ a) mRNA, DNA, amino acids b) mRNA, rRNA,...

Translation uses ___ and ____ to synthesize ________ a) mRNA, DNA, amino acids b) mRNA, rRNA, polypeptide chains c) mRNA, tRNA, polypeptide chains d) rRNA, tRNA, amino acids Teacher says a is wrong