HomeworkLib
Question

Some women who are heterozygous for mutations associated with X-linked recessive diseases exhibit symptoms. Why? Select...

Some women who are heterozygous for mutations associated with X-linked recessive diseases exhibit symptoms. Why?

Select one:

a. Translocations result in the gene being autosomal in these women

b. These disease genes are located in the pseudoautosomal region of the X chromosome

c. The disease-causing alleles in these women contain loss-of-function mutations

d. The X chromosome bearing the wild type allele is inactivated in many of these women’s cells

science   biology   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

Answer: d The X chromosome bearing the wild type allele is inactivated in many women's cell.

Explanation: we all know to compensate for the double dose of the X chromosome in females a phenomenon known as dosage compensation is occurred in which one of the x chromosomes is inactivated. And this may cause the occurrence of X-linked recessive disease in heterozygotic females as in case of Fabry disease

0 0
Add a comment
Know the answer?
Add Answer to:
Some women who are heterozygous for mutations associated with X-linked recessive diseases exhibit symptoms. Why? Select...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • 10. Red green colorblindness is an X-linked recessive disease. That means that it is carried on...

    10. Red green colorblindness is an X-linked recessive disease. That means that it is carried on the X chromosome, so men have just one copy of the gene while women have two. In women, both copies must be the recessive disease allele in order to show the disease phenotype, but because men only have one allele, just one recessive allele causes the disease phenotype. Matt and Kate both have normal vision, but Kate's father is colorblind. Use X for the...

  • In mice, the dominant allele Gs of the X-linked gene Greasy produces shiny fur, while the...

    In mice, the dominant allele Gs of the X-linked gene Greasy produces shiny fur, while the recessive wild type Gs+ allele determines normal fur. The dominant allele Bhd of the X-linked Broadhead gene causes skeletal abnormalities including broad heads and snouts, while the recessive wild-type Bhd+ allele yields normal skeletons. Female mice heterozygous for the two alleles of both genes were mated with wild-type males. Among 100 male progeny of this cross, 49 had shiny fur, 48 had skeletal abnormalities,...

  • 43. Genes a and b are X-linked and are located 7 mu apart on the X...

    43. Genes a and b are X-linked and are located 7 mu apart on the X chromosome of Drosophila. A female of genotype a+ b/a b+ is mated with a wild-type (a+b+/Y). a. What is the probability that one of her sons will be either a+b+ or a b+ in phenotype? b. What is the probability that one of her daughters will be a+b+ in phenotype? 44. Three recessive autosomal mutations in Drosophila: a versus wild-type A. b versus B,...

  • In Drosophila, a fully hetero sophila, a fully heterozygous female with the X-linked recessive genes a...

    In Drosophila, a fully hetero sophila, a fully heterozygous female with the X-linked recessive genes a bande not necessarily in that order on the chromosome) was mated to ma c(not necessarily in that order on the chromosom in that order on the chromosome). The offspring occurred in the following phenotypic ratios: Phenotypes Numbers wildtype ac,b 426 428 cb b, a c, a Total 1000 a) What is the arrangement among the genes? Which gene is in the middle? b) What...

  • Polydactyly is a X-linked recessive disorder, which results in cats having extra toes in one or...

    Polydactyly is a X-linked recessive disorder, which results in cats having extra toes in one or several of their paws. It results from a mutation in Gene T. Section of the wild type and polydactyly alleles contain the following sequence: Wild type Allele (T): AAAGTTCAAAGCTTGTTAGCATGAATTCGGTAGGATATAAGCTTAGGTAGGTAGTTCGTA Polydactyly Allele (t): AAAGTTCAAAGCTTGTTAGCATGAATTCGGTAGGATATAATCTTAGGTAGGTAGTTCGTA You are a geneticist and would like to test a litter of kittens. After isolating the DNA, you plan to cut it with a restriction enzyme and run the fragments on...

  • Inheritance and Mutations in a Single-Gene Disorder (10pts - all questions worth 0.5pts) Some diseases are...

    Inheritance and Mutations in a Single-Gene Disorder (10pts - all questions worth 0.5pts) Some diseases are caused by the environment. For example, exposure to chemicals or extremely bright lights can cause certain forms of blindness. But other forms of blindness are inherited, meaning that they are passed on from one generation to another. In this activity, you will learn about a young woman, Molly Troxel, who has an inherited form of blindness called Leber congenital amaurosis (LCA). The activity explores...

  • Canavan disease is an autosomal recessive disease that causes progressive damage to nerve cells in the...

    Canavan disease is an autosomal recessive disease that causes progressive damage to nerve cells in the brain. Symptoms such as mental retardation, loss of motor skills and abnormal muscle tone progress rapidly beginning in infancy. The disease is fatal with no cure, and death usually occurs before age 4. This disease is caused by mutations in the gene for aspartoacylase on chromosome 17. In the Ashkenazi Jewish population, 1 in 10,000 persons are born with the disease. Assuming that this...

  • genetics If Drosophila, the oval (ov) locus is on the X-chromosome. Recessive mutants make the eyes...

    genetics If Drosophila, the oval (ov) locus is on the X-chromosome. Recessive mutants make the eyes oval instead of the normal round. Furthermore, it is known that when two mutations occur within the oval gene, the phenotype is a more extreme oval phenotype. The genes sn and v are closely linked to the right and left of oval, respectively. Two single mutations ov1 and ov3 were obtained and used in the following experiments. In 10,000 progeny of a female of...

  • 16. So far we have been dealing with alleles found on autosomal chromosomes. These chromosomes contain...

    16. So far we have been dealing with alleles found on autosomal chromosomes. These chromosomes contain all the genetic information that is not gender related. As a human, you have 44 autosomal chromosomes (22 pairs → 11 chromosomes from your Mom and 11 chromosomes from your Dad). You also contain a pair of sex chromosomes. These chromosomes contain all the genetic information related to your gender. If you are female, you received an X chromosome from your Mom and an...

  • 7.) Haemophilia is an X-linked recessive disorder. If a male haemophiliac mates with a normal (non-haemophiliac)...

    7.) Haemophilia is an X-linked recessive disorder. If a male haemophiliac mates with a normal (non-haemophiliac) homozygous woman, would the progeny be affected? a. All males would be carriers. All females would be normal. b. All males would be normal. Half of the females would be carriers and half of the females would have haemophilia. c. All males would be normal. All females would be carriers. d. Half of each sex would be normal and half of each sex would...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT