If a restriction enzyme recognizes four sites in the chromosome, what will result from treating the...
Homework Answers
Answer to the above question:
If a restriction enzyme recognizes four sites in the chromosome, it will make frequent cuts and generate relatively smaller fragments. After digestion, DNA fragments are separated in agarose gel using Pulse Field Gel Electrophoresis (PFGE). Using this technique, DNA fragments of upto 10Mbp can be separated as against less than 40kbp which can be separated using conventional agarose gel electrophoresis.
Add Answer to:
If a restriction enzyme recognizes four sites in the
chromosome, what will result from treating the...
1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this...
1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this plasmid into two fragments. A. True B. False 2.In general, restriction enzymes that recognize four nucleotides have higher probability to produce more DNA fragments than those enzymes that recognize six nucleotides. A. true B. false 3. Which of the following sequences are palindromes? A. 5' TGGCCA 3' B. 5' GAAAAG 3' C. 5' CGATGG 3' D. 5' GACGAC 3' 4. Below are the possible...
A circular DNA molecule digested with a restriction enzyme which has 4 recognition sites on that...
A circular DNA molecule digested with a restriction enzyme which has 4 recognition sites on that molecule will result in how many fragments?
Question #4 (5 pts): Select a restriction enzyme, determine its cleavage sites, which organism is was derived from and how this enzyme doesn't cleave in the organism it is derived (minus poin...
Question #4 (5 pts): Select a restriction enzyme, determine its cleavage sites, which organism is was derived from and how this enzyme doesn't cleave in the organism it is derived (minus points if you choose enzymes found in the text)?
Question #4 (5 pts): Select a restriction enzyme, determine its cleavage sites, which organism is was derived from and how this enzyme doesn't cleave in the organism it is derived (minus points if you choose enzymes found in the text)?
1) If a restriction enzyme cuts a circular DNA into five fragments, how many restriction sites...
1) If a restriction enzyme cuts a circular DNA into five fragments, how many restriction sites are there in the DNA? 2) How many molecules of DNA will be present after 6 cycles of PCR, if you started with one double-stranded DNA molecule? CELL BIOLOGY QUESTIONS!! SHOW WORK PLEASE
CHAPTER 14: Using the restriction enzyme indicated, predict HOW MANY fragments will result after using that...
CHAPTER 14: Using the restriction enzyme indicated, predict HOW MANY fragments will result after using that enzyme to cut the DNA. Cut the DNA using Ddel 5' - TAGAGATCATTAATCCGGTGATCCAGGATTAATAGATCACTAG - 3' EcoR I recognizes the sequence 5²-ATT AAT-3' Hind III recognizes the sequence 5-GA-TC-3' Rsa I recognizes the sequence 5²-CC-GG-3' Dde I recognizes the sequence 5'-CCC GGG-3' Select one: a. 1 O b.4 Oc.2 O d. 5 e. 3 Check
Question #4 (5 pts): Select a restriction enzyme, determine its cleavage sites, which organism is was...
Question #4 (5 pts): Select a restriction enzyme, determine its cleavage sites, which organism is was derived from and how this enzyme doesn't cleave in the organism it is derived (minus points if you choose enzymes found in the text)?
EcoRI is a common restriction enzyme used in cloning experiments. Its restriction sequence is G’AATTC. The...
EcoRI is a common restriction enzyme used in cloning experiments. Its restriction sequence is G’AATTC. The strand is cut at the position of the apostrophe. The 50 base pair sequence shown below contains one or more EcoRI sites. Find them and circle them. Then count the resulting size (in base pairs – bp) of the DNA fragments (pieces) left over after using EcoRI to cut this DNA sequence. Circle the EcoRI sites in the sequence below. 1- ggagaattcgctgtacgaggttaaccccgatgccATGGCATGAATTCGTG -50 List...
A restriction digest of a circular plasmid is conducted using two different restriction enzymes. Restriction enzyme...
A restriction digest of a circular plasmid is conducted using two different restriction enzymes. Restriction enzyme 1 cuts the plasmid in one place while restriction enzyme 2 cuts in two places. All restriction sites are at least 1kB apart from each other. Based on this information, the resulting gel should have _____ bands for the enzyme 1 reaction, _____ bands for the enzyme 2 reaction, and _____ bands for the reaction that contains both enzymes A 1; 2; 3 B...
Pstl is a restriction enzyme produced by the bacterium Providencia stuartii. It recognizes the six base...
Pstl is a restriction enzyme produced by the bacterium Providencia stuartii. It recognizes the six base pair sequence 5-CTGCAG-3. Why is the chromosome of P. stuartii not degraded by Psti? CAR P. stuarti DNA is unmethylated within the recognition sequence for Pstl, and is not degraded by Pstl, which only digests methylated DNA B. It is not understood why the P. stuartii genome is not degraded by Psti. C. P. stuarti DNA is methylated within the recognition sequence for Pstl,...
Restriction enzyme Fnu4HI cuts a four nucleotide DNA sequence GCGC. Assuming that the GC content of...
Restriction enzyme Fnu4HI cuts a four nucleotide DNA sequence
GCGC. Assuming that the GC content of a DNA molecule is 50%, what
will be the average size of a Fnu4HI fragment?
Restriction enzyme Fnu4Hl cuts a four nucleotide DNA sequence GCGC. Assuming that the GC content of a DNA molecule is 50%, what will be the average size of a Fnu4Hl fragment? O A: 0.25 kb O'B: 0.50 kb O C: 1 kb OD: 2 kb UE: 4 kb
Question #4 (5 pts): Select a restriction enzyme, determine its cleavage sites, which organism is was derived from and how this enzyme doesn't cleave in the organism it is derived (minus points if you choose enzymes found in the text)?
Question #4 (5 pts): Select a restriction enzyme, determine its cleavage sites, which organism is was derived from and how this enzyme doesn't cleave in the organism it is derived (minus points if you choose enzymes found in the text)?
CHAPTER 14: Using the restriction enzyme indicated, predict HOW MANY fragments will result after using that enzyme to cut the DNA. Cut the DNA using Ddel 5' - TAGAGATCATTAATCCGGTGATCCAGGATTAATAGATCACTAG - 3' EcoR I recognizes the sequence 5²-ATT AAT-3' Hind III recognizes the sequence 5-GA-TC-3' Rsa I recognizes the sequence 5²-CC-GG-3' Dde I recognizes the sequence 5'-CCC GGG-3' Select one: a. 1 O b.4 Oc.2 O d. 5 e. 3 Check
Question #4 (5 pts): Select a restriction enzyme, determine its cleavage sites, which organism is was derived from and how this enzyme doesn't cleave in the organism it is derived (minus points if you choose enzymes found in the text)?
Pstl is a restriction enzyme produced by the bacterium Providencia stuartii. It recognizes the six base pair sequence 5-CTGCAG-3. Why is the chromosome of P. stuartii not degraded by Psti? CAR P. stuarti DNA is unmethylated within the recognition sequence for Pstl, and is not degraded by Pstl, which only digests methylated DNA B. It is not understood why the P. stuartii genome is not degraded by Psti. C. P. stuarti DNA is methylated within the recognition sequence for Pstl,...
Restriction enzyme Fnu4HI cuts a four nucleotide DNA sequence
GCGC. Assuming that the GC content of a DNA molecule is 50%, what
will be the average size of a Fnu4HI fragment?
Restriction enzyme Fnu4Hl cuts a four nucleotide DNA sequence GCGC. Assuming that the GC content of a DNA molecule is 50%, what will be the average size of a Fnu4Hl fragment? O A: 0.25 kb O'B: 0.50 kb O C: 1 kb OD: 2 kb UE: 4 kb
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago