Which of the two (genomic or mRNA sequence) Is more useful for drawing a conclusion regarding...
Which of the two (genomic or mRNA sequence) Is more useful for drawing a conclusion regarding homology?
Homework Answers
mRNA sequence is more useful for drawing a conclusion regarding homology. Because, genomic DNA contains intron or noncoding sequences withing the coding regions (or exons). But mRNA is only transcribed and processed to form coding sequence that can be translated to protein (amino acid) sequences.
Homology analysis is performed to find out relatedness of two or more organisms based on their gene or protein sequences.
In genomic DNA sequence, the functional protein coding regions are discretely present separated by introns. So, differences in intron sequences also make some homology scores though these do not actually contribute to any functional properties of an organism.
Instead, differences in mRNA sequences actually tells us about the changes in functional segments of the gene. So, mRNA sequence based homology analysis will be more conclusive and appropriate.
Add Answer to:
Which of the two (genomic or mRNA sequence) Is more
useful for drawing a conclusion regarding...
is genomic or mRNA sequence more useful for drawing a conclusion regarding homology? why?
is genomic or mRNA sequence more useful for drawing a conclusion regarding homology? why?
Problem 4 The following are questions regarding cDNA and genomic libraries e. What sequence(s) is lacking...
Problem 4 The following are questions regarding cDNA and genomic libraries e. What sequence(s) is lacking in a genomic library that is present in a cDNA library? f.Would you be likely to find an average longer ORF in cloned sequences from a genomic library or from a cDNA library? Explain g. If you sequenced a new organism how would estimate how many genes are in the genome? List at least two ways you could do this.
Sequence 1: 5' TAGGTGAAAGAGTAGCCTAGAATCAGTTA 3' Sequence 2: 5' TAACTGATTTCTTTCACCTA 3' a. Which sequence is the genomic...
Sequence 1: 5' TAGGTGAAAGAGTAGCCTAGAATCAGTTA 3' Sequence 2: 5' TAACTGATTTCTTTCACCTA 3' a. Which sequence is the genomic fragment and which is the cDNA fragment? b. Write the RNA-like strand of the genomic sequence and indicate the 5' and 3 ends. Draw vertical lines between the bases that are the exon/ intron boundaries (Refer to the figure below for splice junction sequences.) (a) Short sequences dictate where splicing occurs. 30 nucleotides Exon 1 5' Intron Exon 2 3' Pu Pu GUPu Pu...CACUGAC...
Which of the following statements is true regarding homology and homologous sequences. a)If two sequences are...
Which of the following statements is true regarding homology and homologous sequences. a)If two sequences are homologs then they are also paralogs b)If two sequences are homologs then they are also orthologs c)If two sequences can be aligned via a sequence alingment then they are homologs. d)Suppose tha there are n differences between two sequences ,and that the probability of this ocurring at random is less than 0.05.Then the sequences are homologs. e)All of the above f)None of the above
Which of the following statements is true regarding homology and homologous sequences. a)If two sequences are...
Which of the following statements is true regarding homology and homologous sequences. a)If two sequences are homologs then they are also paralogs b)If two sequences are homologs then they are also orthologs c)If two sequences can be aligned via a sequence alingment then they are homologs. d)Suppose tha there are n differences between two sequences ,and that the probability of this ocurring at random is less than 0.05.Then the sequences are homologs. e)All of the above f)None of the above
1 a. Which prokaryotic ribosomal subunit binds the mRNA? b. What is the sequence in the...
1 a. Which prokaryotic ribosomal subunit binds the mRNA? b. What is the sequence in the mRNA called that facilitates this interaction, and where is it located? c. Which specific component within this particular subunit facilitates binding to the mRNA?
1.) In which direction is RNA transcribed? 2.) Which of the two strands (A or...
1.) In which direction is RNA transcribed?
2.) Which of the two strands (A or B) serves as the TEMPLATE
strand for the transcription of a mRNA that contains both a start
and a stop codon?
3.) Which number (1, 2, 3, 4, or 5) best approximates the
location of the -10 consensus sequence?
4.) How many amino acids long is the protein encoded by the mRNA
from this DNA sequence?
5.) What is the second...
Which of the following statements regarding the TATA binding protein (TBP) are true: Recognizes a sequence...
Which of the following statements regarding the TATA binding protein (TBP) are true: Recognizes a sequence that is similar are identical to 5'TATAAA3' Ο Ο Ο All are correct. It is considered a universal transcription factor It is a part of TEIID protein complex It binds to a consensus sequence The backbone of a DNA molecule is made up of phosphate groups made up of sugars made up of alternating phosphate and sugar groups Made up of alternating sugars and...
Which of the following statements regarding nucleic acids is correct? A. mRNA codes for proteins. B....
Which of the following statements regarding nucleic acids is correct? A. mRNA codes for proteins. B. tRNA makes lipids C. mRNA codes for DNA D. tRNA makes amino acids
QUESTION 11 Meselson and Stahl had obtained the resuk below, what would have been there conclusion...
QUESTION 11 Meselson and Stahl had obtained the resuk below, what would have been there conclusion First Generation Replication Replication N4 14 NINIS NAS N15 DNA replication is conservative DNA replication is semi-conservative DNA replication is dispersive None of the above QUESTION 12 If one strand of DNA Is CGGTAC in the 5-3 direction, what is the corresponding complementary strand of DNA in the 53' direction? GCCTAG ©GTACG TAACGT GCCATG CATGGA QUESTION 13 Which of the following statements regarding the...
Sequence 1: 5' TAGGTGAAAGAGTAGCCTAGAATCAGTTA 3' Sequence 2: 5' TAACTGATTTCTTTCACCTA 3' a. Which sequence is the genomic fragment and which is the cDNA fragment? b. Write the RNA-like strand of the genomic sequence and indicate the 5' and 3 ends. Draw vertical lines between the bases that are the exon/ intron boundaries (Refer to the figure below for splice junction sequences.) (a) Short sequences dictate where splicing occurs. 30 nucleotides Exon 1 5' Intron Exon 2 3' Pu Pu GUPu Pu...CACUGAC...
1.) In which direction is RNA transcribed?
2.) Which of the two strands (A or B) serves as the TEMPLATE
strand for the transcription of a mRNA that contains both a start
and a stop codon?
3.) Which number (1, 2, 3, 4, or 5) best approximates the
location of the -10 consensus sequence?
4.) How many amino acids long is the protein encoded by the mRNA
from this DNA sequence?
5.) What is the second...
Which of the following statements regarding the TATA binding protein (TBP) are true: Recognizes a sequence that is similar are identical to 5'TATAAA3' Ο Ο Ο All are correct. It is considered a universal transcription factor It is a part of TEIID protein complex It binds to a consensus sequence The backbone of a DNA molecule is made up of phosphate groups made up of sugars made up of alternating phosphate and sugar groups Made up of alternating sugars and...
QUESTION 11 Meselson and Stahl had obtained the resuk below, what would have been there conclusion First Generation Replication Replication N4 14 NINIS NAS N15 DNA replication is conservative DNA replication is semi-conservative DNA replication is dispersive None of the above QUESTION 12 If one strand of DNA Is CGGTAC in the 5-3 direction, what is the corresponding complementary strand of DNA in the 53' direction? GCCTAG ©GTACG TAACGT GCCATG CATGGA QUESTION 13 Which of the following statements regarding the...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago