PDB entry 1JY4 is a/n ___-stranded b sheet where each strand is arranged in a/n ________...
PDB entry 1JY4 is a/n ___-stranded b sheet where each strand is arranged in a/n ________ fashion.
A.
|
6; antiparallel |
B.
|
6; parallel |
C.
|
8; parallel |
D.
|
8; antiparallel |
In a ribbon diagram of the structure of 1JY4, each strand of the b sheet is represented by an arrow that points towards the _____________.
A.
|
C-terminus |
B.
|
N-terminus |
Homework Answers
Add Answer to:
PDB entry 1JY4 is a/n ___-stranded b sheet where each strand is
arranged in a/n ________...
PDB entry 2BEG contains a total of 5 oligopeptides; each oligopeptide participates in ___ unique β...
PDB entry 2BEG contains a total of 5 oligopeptides; each oligopeptide participates in ___ unique β sheet/s whose strands are arranged in a/n ________ fashion. 2; antiparallel 1; parallel 2; parallel 1; antiparallel
PDB entry 2BEG contains a total of 5 oligopeptides; each oligopeptide participates in ___ unique β...
PDB entry 2BEG contains a total of 5 oligopeptides; each oligopeptide participates in ___ unique β sheet/s whose strands are arranged in a/n ________ fashion. choices are: 1; antiparallel 2; antiparallel 1;parallel 2;parallel
The picture below shows a four-stranded b-sheet, with the strands labeled “A” through “D”. (Note that...
The picture below shows a four-stranded b-sheet, with
the strands labeled “A” through “D”. (Note that the R-groups
have been removed.) Carbons are black; nitrogens are blue; and
oxygens are red.
A. In the box next to Strand “B”, draw an arrow showing the N-to-C
direction of the polypeptide chain.
B. What pair(s) of neighboring strands are anti-parallel?
C. What pair(s) of neighboring strands are parallel?
D. How many residues are in Strand “B”?
COULD YOU PLEASE SENT SOLUTION? IT...
The secondary structure shown below is an example of an) N N A beta turn B....
The secondary structure shown below is an example of an) N N A beta turn B. parallel beta sheet C antiparallel beta sheet D. right handed alpha helix Which amino acid would be most stabilizing at the N-terminus of an a-hellx (pH=7.0)? A Lysine B. Asparagine C Glutamine D. Glutamate
The following is a fragment of double stranded DNA . The bottom strand is the template...
The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...
group on the 13. In double-stranded DNA, a pyrimidine group on one strand base pairs with...
group on the 13. In double-stranded DNA, a pyrimidine group on one strand base pairs with a other strand; the two strands are oriented in directions. a. purine, parallel b. purine, antiparallel c. pyrimidine, parallel d. pyrimidine, antiparallel Questions 14 and 15 refer to the following information: A disaccharide composed of arabinose and xylose gives arabinose and xylonic acid by reaction with Bry-water followed by hydrolysis. Reaction of its methyl glycoside with iodomethane under basic conditions followed by hydrolysis gives...
2) A very large number of very long wires are arranged to form a current-carrying “ribbon,"...
2) A very large number of very long wires are arranged to form a current-carrying “ribbon," as shown in the figure below. Each wire can be assumed to have negligible radius and carries the same current I (in the same direction). The ribbon is oriented in the xy-plane, at z =0. Hint: This problem has planar symmetry, so consider how you might apply Ampere's Law. Also note that this problem is equivalent to an infinite current-carrying sheet with surface a...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...
Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...
Expert Q&A Done 1. Is this strand the sense strand or anti-sense strand? What is your evidence (H...
Expert Q&A Done 1. Is this strand the sense strand or anti-sense strand? What is your evidence (How did you know)? So is this the template or coding strand? 2. How would you locate the general area of the promoter? Hint: what sequence would you look for? Underline the sequence and label with an (a). What sequence would you look for if the complementary strand was provided? (Always write answers in 5 to 3" unless otherwise 3. How many exons...
The picture below shows a four-stranded b-sheet, with
the strands labeled “A” through “D”. (Note that the R-groups
have been removed.) Carbons are black; nitrogens are blue; and
oxygens are red.
A. In the box next to Strand “B”, draw an arrow showing the N-to-C
direction of the polypeptide chain.
B. What pair(s) of neighboring strands are anti-parallel?
C. What pair(s) of neighboring strands are parallel?
D. How many residues are in Strand “B”?
COULD YOU PLEASE SENT SOLUTION? IT...
The secondary structure shown below is an example of an) N N A beta turn B. parallel beta sheet C antiparallel beta sheet D. right handed alpha helix Which amino acid would be most stabilizing at the N-terminus of an a-hellx (pH=7.0)? A Lysine B. Asparagine C Glutamine D. Glutamate
group on the 13. In double-stranded DNA, a pyrimidine group on one strand base pairs with a other strand; the two strands are oriented in directions. a. purine, parallel b. purine, antiparallel c. pyrimidine, parallel d. pyrimidine, antiparallel Questions 14 and 15 refer to the following information: A disaccharide composed of arabinose and xylose gives arabinose and xylonic acid by reaction with Bry-water followed by hydrolysis. Reaction of its methyl glycoside with iodomethane under basic conditions followed by hydrolysis gives...
2) A very large number of very long wires are arranged to form a current-carrying “ribbon," as shown in the figure below. Each wire can be assumed to have negligible radius and carries the same current I (in the same direction). The ribbon is oriented in the xy-plane, at z =0. Hint: This problem has planar symmetry, so consider how you might apply Ampere's Law. Also note that this problem is equivalent to an infinite current-carrying sheet with surface a...
Expert Q&A Done 1. Is this strand the sense strand or anti-sense strand? What is your evidence (How did you know)? So is this the template or coding strand? 2. How would you locate the general area of the promoter? Hint: what sequence would you look for? Underline the sequence and label with an (a). What sequence would you look for if the complementary strand was provided? (Always write answers in 5 to 3" unless otherwise 3. How many exons...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago