Question

PDB entry 1JY4 is a/n ___-stranded b sheet where each strand is arranged in a/n ________...

PDB entry 1JY4 is a/n ___-stranded b sheet where each strand is arranged in a/n ________ fashion.

A.

6; antiparallel

B.

6; parallel

C.

8; parallel

D.

8; antiparallel

In a ribbon diagram of the structure of 1JY4, each strand of the b sheet is represented by an arrow that points towards the _____________.

A.

C-terminus

B.

N-terminus

0 0
Add a comment Improve this question Transcribed image text
Know the answer?
Add Answer to:
PDB entry 1JY4 is a/n ___-stranded b sheet where each strand is arranged in a/n ________...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • PDB entry 2BEG contains a total of 5 oligopeptides; each oligopeptide participates in ___ unique β...

    PDB entry 2BEG contains a total of 5 oligopeptides; each oligopeptide participates in ___ unique β sheet/s whose strands are arranged in a/n ________ fashion. 2; antiparallel 1; parallel 2; parallel 1; antiparallel

  • PDB entry 2BEG contains a total of 5 oligopeptides; each oligopeptide participates in ___ unique β...

    PDB entry 2BEG contains a total of 5 oligopeptides; each oligopeptide participates in ___ unique β sheet/s whose strands are arranged in a/n ________ fashion. choices are: 1; antiparallel 2; antiparallel 1;parallel 2;parallel

  • The picture below shows a four-stranded b-sheet, with the strands labeled “A” through “D”. (Note that...

    The picture below shows a four-stranded b-sheet, with the strands labeled “A” through “D”. (Note that the R-groups have been removed.) Carbons are black; nitrogens are blue; and oxygens are red. A. In the box next to Strand “B”, draw an arrow showing the N-to-C direction of the polypeptide chain. B. What pair(s) of neighboring strands are anti-parallel? C. What pair(s) of neighboring strands are parallel? D. How many residues are in Strand “B”? COULD YOU PLEASE SENT SOLUTION? IT...

  • The secondary structure shown below is an example of an) N N A beta turn B....

    The secondary structure shown below is an example of an) N N A beta turn B. parallel beta sheet C antiparallel beta sheet D. right handed alpha helix Which amino acid would be most stabilizing at the N-terminus of an a-hellx (pH=7.0)? A Lysine B. Asparagine C Glutamine D. Glutamate

  • The following is a fragment of double stranded DNA . The bottom strand is the template...

    The following is a fragment of double stranded DNA . The bottom strand is the template strand. It encodes a hypothetical 6 amino protein & includes the start (initiator) codon, a small amount of 5’ UTR, and a small amount of 3’ UTR TTGGCAATGTGATCCCTTGTGCGGTACCACT AACCGTTACACTAGGGAACACGCCATGGTGA (Template strand) The bottom strand is the template strand and the RNA polymerase will always move from right-to-left, this is the direction of RNA synthesis RNA transcript compares to the non-template strand by being exactly...

  • group on the 13. In double-stranded DNA, a pyrimidine group on one strand base pairs with...

    group on the 13. In double-stranded DNA, a pyrimidine group on one strand base pairs with a other strand; the two strands are oriented in directions. a. purine, parallel b. purine, antiparallel c. pyrimidine, parallel d. pyrimidine, antiparallel Questions 14 and 15 refer to the following information: A disaccharide composed of arabinose and xylose gives arabinose and xylonic acid by reaction with Bry-water followed by hydrolysis. Reaction of its methyl glycoside with iodomethane under basic conditions followed by hydrolysis gives...

  • 2) A very large number of very long wires are arranged to form a current-carrying “ribbon,"...

    2) A very large number of very long wires are arranged to form a current-carrying “ribbon," as shown in the figure below. Each wire can be assumed to have negligible radius and carries the same current I (in the same direction). The ribbon is oriented in the xy-plane, at z =0. Hint: This problem has planar symmetry, so consider how you might apply Ampere's Law. Also note that this problem is equivalent to an infinite current-carrying sheet with surface a...

  • Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains...

    Below is a portion of DNA sequence, introns are shown in bold. Determine which strand contains a start codon and could serve as the template for synthesis of an mRNA molecule. 5’ ATCGCGCTCAGCTAGTACCGATCAGCAGTCAGCAGTCAGCATCGGT 3’ (top) 3’ TAGCGCGAGTCGATCATGGCTAGTCGTCAGTCGTCAGTCGTAGCCA 5’ (bottom) a. Which strand will serve as the template strand for transcription? b. Based on the template strand you have chosen, write the mature mRNA sequence on your answer sheet in the 5’ to 3’ direction. Be sure to label 5’ and...

  • Expert Q&A Done 1. Is this strand the sense strand or anti-sense strand? What is your evidence (H...

    Expert Q&A Done 1. Is this strand the sense strand or anti-sense strand? What is your evidence (How did you know)? So is this the template or coding strand? 2. How would you locate the general area of the promoter? Hint: what sequence would you look for? Underline the sequence and label with an (a). What sequence would you look for if the complementary strand was provided? (Always write answers in 5 to 3" unless otherwise 3. How many exons...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT