Restriction enzymes produce DNA fragments that are always the same size. True or False ?
Answer: False.
Explanation: Restriction enzymes are those enzymes that cut the DNA. These enzymes cut the DNA at the specific sequence along the DNA. Two restriction enzyme have different restriction sizes so the length of the fragments cut by restriction enzymes would not be same.
Restriction enzymes produce DNA fragments that are always the same size. True or False ?
RESTRICTION DIGEST ANALYSIS QUESTIONS(true or yes = A: false or no = b) 1. Larger DNA fragments appear near the bottom of the gel. 2. Larger DNA fragments move more rapidly through the gel. D ONA that has many restriction sites for a certain endonuclease will be cut into more fragmets than DNA with fewer restriction sites. 4. Cutting DNA with many different endonucleases will result in more DNA fragments. 5. Restriction enzymes all recognize the same base sequence when...
What are restriction enzymes and how do they affect DNA? Why do some fragments move quickly and some move slowly through an agarose gel? How can type II restriction enzymes and agarose gels be used to identify samples from individuals with the similar DNA sequence?
True or false? Restriction digestion is required for PCR amplifying DNA. Ampicillin is a gene that encodes for ampicillin resistance. The ends produced by the endonuclease can be rejoined by a ligase, which closes the break in the hydrogen bonds formed by the complementary DNA nucleotides. Restriction recognition sites typically have a palindrome structure. During DNA ligation, DNA fragments with compatible sticky ends have a higher ligation efficiency than DNA fragments with blunt ends. PCR is a technique used to...
Which of the following makes restriction enzymes useful for DNA fingerprinting and RFLP analysis? a. they typically attach and ligate DNA fragments together b. they cause DNA to be translated into the plasmid c. they cause DNA to be transcribed into the plasmid d. they can only function when within the cytoplasm of a cell e. none of the others are true
Which of the following enzymes joins the paired sticky ends of DNA fragments? a. reverse transcriptase b. restriction enzymes c. DNA ligase d. DNA polymerase e. helicase
1. A circular plasmid has two PmeI restriction sites. A PmeI restriction enzyme will cut this plasmid into two fragments. A. True B. False 2.In general, restriction enzymes that recognize four nucleotides have higher probability to produce more DNA fragments than those enzymes that recognize six nucleotides. A. true B. false 3. Which of the following sequences are palindromes? A. 5' TGGCCA 3' B. 5' GAAAAG 3' C. 5' CGATGG 3' D. 5' GACGAC 3' 4. Below are the possible...
You are using three restriction enzymes to digest a double-stranded DNA in which the sequence of the upper strand is 5'-TTGTCGATGCGAATTCGGTGATGGATCCTAGGTCGTGTAGCATGCATGCCGGATCCTAGCTGAGC'-3. The recognition sites of the enzymes are G'AATTC (EcoRI), G'GATCC (BamHI), and GCATG'C (SphI). The cleavage sites are indicated with '. Determine how long the DNA fragments will be after digesting the DNA with each of these enzymes individually. Additionally, determine the length of the fragments if you digest with both enzymes BamHI and SphI. In a drawing, show...
Restriction Mapping of a Linear DNA • 2 DNA is a linear and double-stranded DNA isolated from bacteriophage lambda. This bacteriophage is a virus that infects E. coli and can undergo specialized transduction (see the transduction lab lecture). Assuming you obtained the following fragments from the restriction digestion. Draw the restriction map for the EcoRI and Hindi II enzymes in the 2. DNA. Fragment Size EcoRI 15300 6200 5250 2100 EcoRI + HindIII 15300 4400 4000 2100 1800 Hind!!! 17100...
DNA fragments cut by most restriction enzymes have: double-stranded complementary ends. either only sequences of Gs or only sequences of Cs. cuts made at random points along one of the strands. protruding sticky ends.
find the errors
Restriction enzymes recognize specific DNA sequences and cut each strand of DNA at specific locations at the target sequence. The result of digesting a particular genome with a particular restriction enzyme is a collection of restriction fragments of defined length and composition. These can be used to generate restriction maps or create pieces with sticky ends. These sticky ends can be used to attach to other fragments that have sticky ends caused by cutting with a different...