1. During the process of translating a protein into the lumen of the rough ER, the signal recognition particle (SRP) binds to both
the signal sequence and the signal peptidase.
the signal sequence and the SRP receptor.
the start codon and the small ribosomal subunit.
the start codon and the SRP receptor.
2. Each of the following modification processes takes place in the nucleus of a eukaryotic cell EXCEPT
addition of a 5’ cap.
addition of a poly-A tail.
mRNA editing.
pre-mRNA editing to remove introns.
3. The poly-A tail of a molecule of mRNA is most likely to protect the translated portion of the mRNA from which of the following?
Degradation by endonuclease enzymes.
Degradation by exonuclease enzymes starting from the 3’ end.
Degradation by exonuclease enzymes starting from the 5’ end.
mRNA editing.
1. The signal sequence and the SRP receptor.
Explanation : SRP binds to the signal sequence of newly synthesized peptide. SRP also targets ribosome-nascent chain complex to translocon via the interaction with SRP receptor.
2. mRNA editing.
Explanation : mRNA editing generally takes place in cytoplasm.
3. Degradation by exonuclease enzymes starting from the 3' end.
Explanation : Poly A tail is located in the 3' end of mRNA thus it protects the mRNA from the exonuclease enzymes starting from 3' end.
**** IF YOU LIKE THE ANSWER PLEASE HIT THE THUMBS-UP. THANK YOU :-)
1. During the process of translating a protein into the lumen of the rough ER, the...
What is the correct order for the following steps in co-translating a soluble protein into the ER lumen? #1 Choose... Translocation of the protein through the translocator begins. Signal sequence is cleaved by signal peptidase. ER Signal sequence binds to the translocator channel. SRP binds SRP Receptor. Translation begins. SRP binds ER signal sequence. Ribosome dissociates from ER membrane. Translation of the polypeptide finishes. Ribosome binds mRNA. Translation pauses. Choose.. Choose... Choose... #9 Choose... #10 Choose...
The role of the signal recognition particle (SRP) in sorting proteins that contain an ER signal sequence is A. the SRP must be associated with a cytosolic ribosome before the ribosome can attach to the ER membrane and initiate translation of an mRNA encoding a protein with an ER signal B. the SRP binds the signal sequence in the cytosol after synthesis of the protein has begun on a ribosome, and escorts the ribosome/mRNA complex to the ER membrane C....
3. Prokaryotic and eukaryotic gene expression compared. Below is an incomplete table of prokaryotic and eukaryotic gene expression in comparison. Fill in the blank using PPT slides, notes and the textbook. Prokaryotic gene expression Eukaryotic gene expression Overview Steps Transcription and translation Yes Transcription and translation coupled? Gene structure No introns Epigenetic modification (chromosome remodeling) transcription, translation, RNA processing, protein processing Transcription in the nucleus and translation in the cytoplasm Interrupted gene with exons and introns RNAPI, II, III Which...
Paragraph Lipod 64. Styles Which of the following is a ribonucleoprotein? A. Signal Recognition Particle B. ribosome C. telomerase D. SnRNP E. all of the above 65._ What is the term for the base pair position in the diagram below? A. ambiguous B. jiggle C. redundant D. triplet E. wobble mini TRNA mRNA 5- 12 Name this position 1711 words Clipboard Font Paragraph amino acid binding site intrastrand hydrogen bonds "charged" tRNA binds to binds to 50S charging enzyme ribosomal...
Please answer all questions
2 After isolating the rough endoplasmic reticulum from the rest of the cytoplasm, you purify the RNAS attached to it. Which of the following proteins do you expect the RNA from the rough endoplasmic reticulum to encode? (a) (c) soluble secreted proteins plasma membrane proteins ER membrane proteins all of the above (b) (d) -13 In which cellular location would you expect to find ribosomes translating MRNAS that encode ribosomal proteins? (a) (c) the nucleus in...
hello, two of these circled answers are incorrect.
1 6. The promoter sequences are the positions that: signal the initiation site of a gene (+1) B) bind the transcriptional factor that is associated with RNA polymerase e) attach the correct nucleotide triphosphate to the template DNA strand D) separate the two DNA strands CUA 7. A particular triplet of bases in the coding sequence of DNA is GAT. The anticodon on the tRNA that binds the mRNA codon is A...
O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...
Hint 1. How is a complete initiation complex formed? Drag the labels to their correct locations in the diagram to describe the roles of the various transcription factors in the formation of a complete initiation complex Reset Help part of initial committed complex TFIIA IIB added during formation of minimal initiation complex sa cosci.ccccccca RNA polymerase II added during formation of complete initiation complex Submit Request Answer Hint 2. How is pre-mRNA processed into mature mRNA? Select the two statements...
Why would changes in the genes for transcription factors be expected to generate major phenotypic differences? They are extremely powerful genes. They can affect the expression of small numbers of other genes. Their gene products are remarkably stable. Their gene products normally denature more rapidly than other gene products. They can affect the expression of large numbers of other genes. Which enzyme, also responsible for siRNA formation, carves miRNAs from their double-stranded, fold- back RNA precursor (pre-miRNA)? Dicer ribonuclease RNA...
answer all the questions
1) All of the following contribute to promoter binding by RNA polymerase I in bacteria except: a)-10 consensus sequence b)-35 consensus sequence c) rho factor d) sigma factor e) none of the above 2) Common structural changes or lesions found in DNA after exposure to ultraviolet light are: a) thymine dimers b) cytosine dimers c) purine dimers d) adenine dimers e) none of the above 3) What is the function of the sigma subunit in the...